Fastq

FASTQ is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity. The format was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA formatted sequence and its quality data.

Format

A FASTQ file normally uses four lines per sequence:

1. A line starting with a '@' character, followed by a sequence identifier and an optional description (like a FASTA title line).
2. The raw sequence letters.
3. A line starting with a '+' character, and optionally followed by the same sequence identifier (and any description).
4. Encoded quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.

Quality Scores

The quality scores are typically Phred-scaled and represent the probability of an incorrect base call. The scores are encoded as ASCII characters, with different encoding schemes used by different sequencing technologies.

Example

A typical FASTQ entry looks like this:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTTCAGTGGTAGAATTTCAGT
+
!*((((*+))%%%++)(%%%%).1*-+*))55CCF>>>>>>CCCCCCC65

Applications

FASTQ files are commonly used in next-generation sequencing (NGS) technologies, such as those produced by Illumina, Roche 454, and Ion Torrent. They are essential for storing raw sequence data and quality scores, which are then used in various bioinformatics analyses, including sequence alignment, variant calling, and genome assembly.

Tools and Software

Several tools and software packages are available for working with FASTQ files, including:

• FASTQC - A quality control tool for high throughput sequence data.
• Seqtk - A toolkit for processing sequences in FASTA/Q formats.
• Trimmomatic - A flexible read trimming tool for Illumina NGS data.

Related Pages

• FASTA format
• Phred quality score
• Next-generation sequencing
• Sequence alignment
• Genome assembly

See Also

• Bioinformatics
• Genomics
• DNA sequencing