Fasta

From WikiMD's Wellness Encyclopedia

FASTA is a bioinformatics software package used for sequence alignment of nucleotide or protein sequences. It was developed by David J. Lipman and William R. Pearson in 1985. The FASTA format is a text-based format for representing either nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences.

History[edit | edit source]

FASTA was one of the first widely used algorithms for sequence alignment and database searching. It introduced the concept of using heuristics to speed up the process of finding similar sequences in large databases. The original FASTA algorithm was designed to search protein databases, but it was later adapted to search nucleotide databases as well.

Algorithm[edit | edit source]

The FASTA algorithm works by first identifying regions of similarity between sequences using a hash table of short words (k-tuples). These regions are then extended to form longer alignments. The algorithm uses a scoring system to evaluate the quality of the alignments, taking into account factors such as gap penalties and substitution matrices.

FASTA Format[edit | edit source]

The FASTA format is simple and consists of a header line followed by lines of sequence data. The header line starts with a ">" character and is followed by a sequence identifier and optional description. The sequence data is represented in a single-letter code, with each line typically containing up to 80 characters. Example of a FASTA format:

 >sequence1
 AGCTGATCGATCGTACGATCG
 >sequence2
 CGTAGCTAGCTAGCTAGCTAG
 

Applications[edit | edit source]

FASTA is widely used in bioinformatics for tasks such as:

Related Software[edit | edit source]

FASTA has inspired the development of several other sequence alignment tools, including:

See Also[edit | edit source]

References[edit | edit source]

External Links[edit | edit source]

WikiMD
Navigation: Wellness - Encyclopedia - Health topics - Disease Index‏‎ - Drugs - World Directory - Gray's Anatomy - Keto diet - Recipes

Search WikiMD

Ad.Tired of being Overweight? Try W8MD's physician weight loss program.
Semaglutide (Ozempic / Wegovy and Tirzepatide (Mounjaro / Zepbound) available.
Advertise on WikiMD

WikiMD's Wellness Encyclopedia

Let Food Be Thy Medicine
Medicine Thy Food - Hippocrates

Medical Disclaimer: WikiMD is not a substitute for professional medical advice. The information on WikiMD is provided as an information resource only, may be incorrect, outdated or misleading, and is not to be used or relied on for any diagnostic or treatment purposes. Please consult your health care provider before making any healthcare decisions or for guidance about a specific medical condition. WikiMD expressly disclaims responsibility, and shall have no liability, for any damages, loss, injury, or liability whatsoever suffered as a result of your reliance on the information contained in this site. By visiting this site you agree to the foregoing terms and conditions, which may from time to time be changed or supplemented by WikiMD. If you do not agree to the foregoing terms and conditions, you should not enter or use this site. See full disclaimer.
Credits:Most images are courtesy of Wikimedia commons, and templates Wikipedia, licensed under CC BY SA or similar.

Contributors: Prab R. Tumpati, MD