Congenital stationary night blindness

From WikiMD's Wellness Encyclopedia
Congenital stationary night blindness
Synonyms
Pronounce
Field
Symptoms
Complications
Onset
Duration
Types
Causes
Risks
Diagnosis
Differential diagnosis
Prevention
Treatment
Medication
Prognosis
Frequency
Deaths


Congenital stationary night blindness (CSNB) is a rare non-progressive retinal disorder. People with CSNB often have difficulty adapting to low light situations due to impaired photoreceptor transmission. These patients may also have reduced visual acuity, myopia, nystagmus, and strabismus. CSNB has two forms -- complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), which are distinguished by the involvement of different retinal pathways. In CSNB1, downstream neurons called bipolar cells are unable to detect neurotransmission from photoreceptor cells. CSNB1 can be caused by mutations in various genes involved in neurotransmitter detection, including NYX, GRM6, and TRPM1. In CSNB2, the photoreceptors themselves have impaired neurotransmission function; this is caused primarily by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel important for neurotransmitter release.

Congenital stationary night blindness (CSNB) can be inherited in an X-linked, autosomal dominant, or autosomal recessive pattern, depending on the genes involved.

Symptoms[edit | edit source]

The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of myopia, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia, reduced visual acuity, strabismus and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod sensitivity (reduced ~300x) as well as cone dysfunction. Patients with the incomplete form can present with either myopia or hyperopia.[1]

Cause[edit | edit source]

CSNB is caused by malfunctions in neurotransmission from rod and cone photoreceptors to bipolar cells in the retina.[2] At this first synapse, information from photoreceptors is divided into two channels: ON and OFF. The ON pathway detects light onset, while the OFF pathway detects light offset.[3] The malfunctions in CSNB1 specifically affect the ON pathway, by hindering the ability of ON-type bipolar cells to detect neurotransmitter released from photoreceptors.[2] Rods, which are responsible for low-light vision, make contacts with ON-type bipolar cells only, while, cones, which are responsible for bright-light vision, make contacts with bipolar cells of both ON an OFF subtypes.[4] Because the low-light sensing rods feed only into the ON pathway, individuals with CSNB1 typically have problems with night vision, while vision in well-lit conditions is spared.[2] In CSNB2, release of neurotransmitter from photoreceptors is impaired, leading to involvement of both ON and OFF pathways.

The electroretinogram (ERG) is an important tool for diagnosing CSNB. The ERG a-wave, which reflects the function of the phototransduction cascade in response to a light flashes, is typically normal in CSNB patients, although in some cases phototransduction is also affected, leading to a reduced a-wave. The ERG b-wave, which primarily reflects the function of ON-bipolar cells, is greatly reduced in CSNB2 cases, and completely absent in CSNB1 cases.[2][5]

Pathophysiology[edit | edit source]

CSNB1[edit | edit source]

The complete form of X-linked congenital stationary night blindness, also known as nyctalopia, is caused by mutations in the NYX gene (Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat (LRR) family protein of unknown function.[6][7] This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients.[8] NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.

Table 1. Mutations in NYX associated with CSNB1
Mutation Position References
Nucleotide Amino acid
c.?-1_?-61del 1_20del Signal sequence [7]
Splicing Intron 1 [9]
c.?-63_1443-?del 21_481del [7]
c.48_64del L18RfsX108 Signal sequence [9]
c.85_108del R29_A36del N-terminal LRR [6]
c.G91C C31S LRRNT [7]
c.C105A C35X LRRNT [7]
c.C169A P57T LRRNT [10]
c.C191A A64E LRR1 [10]
c.G281C R94P LRR2 [11]
c.301_303del I101del LRR2 [7]
c.T302C I101T LRR2 [11]
c.340_351del E114_A118del LRR3 [7][9]
c.G427C A143P LRR4 [7]
c.C452T P151L LRR4 [6]
c.464_465insAGCGTGCCCGAGCGCCTCCTG S149_V150dup+P151_L155dup LRR4 [6]
c.C524G P175R LRR5 [7]
c.T551C L184P LRR6 [6]
c.556_618delins H186?fsX260 LRR6 [6]
c.559_560delinsAA A187K LRR6 [7]
c.613_621dup 205_207dup LRR7 [6][7]
c.628_629ins R209_S210insCLR LRR7 [6]
c.T638A L213Q LRR7 [6]
c.A647G N216S LRR7 [6][9]
c.T695C L232P LRR8 [6]
c.727_738del 243_246del LRR8 [7]
c.C792G N264K LRR9 [6]
c.T854C L285P LRR10 [6]
c.T893C F298S LRR10 [6]
c.C895T Q299X LRR10 [9]
c.T920C L307P LRR11 [7]
c.A935G N312S LRR11 [7]
c.T1040C L347P LRRCT [7]
c.G1049A W350X LRRCT [6]
c.G1109T G370V LRRCT [7]
c.1122_1457del S374RfsX383 LRRCT [7][9]
c.1306del L437WfsX559 C-terminus [9]
LRR: leucine-rich repeat, LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs.

CSNB2[edit | edit source]

Figure 1. Schematic structure of CaV1.4 with the domains and subunits labeled.

The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel CaV1.4 expressed heavily in retina.[12][13] One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptors depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization.[14] This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals.[15] There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.

Table 2. Mutations in CACNA1F associated with CSNB2
Mutation Position Effect References
Nucleotide Amino Acid
c.C148T R50X N-terminus [16]
c.151_155delAGAAA R51PfsX115 N-terminus [17]
c.T220C C74R N-terminus [17]
c.C244T R82X N-terminus [16][17]
c.466_469delinsGTAGGGGTGCT
CCACCCCGTAGGGGTGCTCCACC 		S156VdelPinsGVKHOVGVLH D1S2-3 [16][18][19]
Splicing Intron 4 [16]
c.T685C S229P D1S4-5 [17]
c.G781A G261R D1-pore [17]
c.G832T E278X D1-pore [9][20]
c.904insG R302AfsX314 D1-pore [18]
c.951_953delCTT F318del D1-pore [16]
c.G1106A G369D D1S6 Activates ~20mV more negative than wild-type, increases time to peak current and decreases inactivation, increased Ca2+ permeability. [12][14][16][17][21]
c.1218delC W407GfsX443 D1-2 [13][16][20]
c.C1315T Q439X D1-2 [17]
c.G1556A R519Q D1-2 Decreased expression [12][22]
c.C1873T R625X D2S4 [16][17]
c.G2021A G674D D2S5 [14][16][18]
c.C2071T R691X D2-pore [10]
c.T2258G F753C D2S6 [17]
c.T2267C I756T D2S6 Activates ~35mV more negative than wild-type, inactivates more slowly [23]
Splicing Intron 19 [17]
c.T2579C L860P D2-3 [17]
c.C2683T R895X D3S1-2 [9][10][13][16]
Splicing Intron 22 [17][18]
Splicing Intron 22 [17]
c.C2783A A928D D3S2-3 [14][16]
c.C2905T R969X D3S4 [12][17]
c.C2914T R972X D3S4 [20]
Splicing Intron24 [16]
c.C2932T R978X D3S4 [18]
c.3006_3008delCAT I1003del D3S4-5 [16]
c.G3052A G1018R D3S5 [17]
c.3125delG G1042AfsX1076 D3-pore [16]
c.3166insC L1056PfsX1066 D3-pore [12][13][16][17]
c.C3178T R1060W D3-pore [12][17]
c.T3236C L1079P D3-pore Does not open without BayK, activates ~5mV more negative than wild-type [17][21]
c.3672delC L1225SfsX1266 D4S2 [13][16]
c.3691_3702del G1231_T1234del D4S2 [12][17]
c.G3794T S1265I D4S3 [10]
c.C3886A R1296S D4S4 [10]
c.C3895T R1299X D4S4 [13][16][17]
Splicing Intron 32 [17]
c.C4075T Q1359X D4-pore [12][17]
c.T4124A L1375H D4-pore Decreased expression [12][17][22]
Splicing Intron 35 [17]
c.G4353A W1451X C-terminus Non-functional [13][14][16][21]
c.T4495C C1499R C-terminus [17]
c.C4499G P1500R C-terminus [17]
c.T4523C L1508P C-terminus [17]
Splicing intron 40 [16]
c.4581delC F1528LfsX1535 C-terminus [24]
c.A4804T K1602X C-terminus [12][17]
c.C5479T R1827X C-terminus [17]
c.5663delG S1888TfsX1931 C-terminus [16]
c.G5789A R1930H C-terminus [10]

Genetics[edit | edit source]

Only three rhodopsin mutations have been found associated with congenital stationary night blindness (CSNB).[25] Two of these mutations are found in the second transmembrane helix of rhodopsin at Gly-90 and Thr-94. Specifically, these mutations are the Gly90Asp [26] and the Thr94Ile, which has been the most recent one reported.[27] The third mutation is Ala292Glu, and it is located in the seventh transmembrane helix, in proximity to the site of retinal attachment at Lys-296.[28] Mutations associated with CSNB affect amino acid residues near the protonated Schiff base (PSB) linkage. They are associated with changes in conformational stability and the protonated status of the PSB nitrogen.[29]

Footnotes[edit | edit source]

  1. ↑
  2. ↑ 2.0 2.1 2.2 2.3
  3. ↑
  4. ↑
  5. ↑
  6. ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14
  7. ↑ 7.00 7.01 7.02 7.03 7.04 7.05 7.06 7.07 7.08 7.09 7.10 7.11 7.12 7.13 7.14 7.15 7.16
  8. ↑
  9. ↑ 9.0 9.1 9.2 9.3 9.4 9.5 9.6 9.7 9.8
  10. ↑ 10.0 10.1 10.2 10.3 10.4 10.5 10.6
  11. ↑ 11.0 11.1
  12. ↑ 12.0 12.1 12.2 12.3 12.4 12.5 12.6 12.7 12.8 12.9
  13. ↑ 13.0 13.1 13.2 13.3 13.4 13.5 13.6
  14. ↑ 14.0 14.1 14.2 14.3 14.4
  15. ↑
  16. ↑ 16.00 16.01 16.02 16.03 16.04 16.05 16.06 16.07 16.08 16.09 16.10 16.11 16.12 16.13 16.14 16.15 16.16 16.17 16.18 16.19
  17. ↑ 17.00 17.01 17.02 17.03 17.04 17.05 17.06 17.07 17.08 17.09 17.10 17.11 17.12 17.13 17.14 17.15 17.16 17.17 17.18 17.19 17.20 17.21 17.22 17.23 17.24 17.25 17.26 17.27 17.28
  18. ↑ 18.0 18.1 18.2 18.3 18.4
  19. ↑
  20. ↑ 20.0 20.1 20.2
  21. ↑ 21.0 21.1 21.2
  22. ↑ 22.0 22.1
  23. ↑
  24. ↑
  25. ↑ Pere Garriga, and Joan Manyosa. The eye photoreceptor protein rhodopsin. Structural implications for retinal disease. Volume 528, Issues 1–3, 25 September 2002, Pages 17–22.
  26. ↑ V.R. Rao, G.B. Cohen and D.D. Oprian Nature 367 (1994), pp. 639–642.
  27. ↑ N. al-Jandal, G.J. Farrar, A.S. Kiang, M.M. Humphries, N. Bannon, J.B. Findlay, P. Humphries and P.F. Kenna Hum. Mutat. 13 (1999), pp. 75–81.
  28. ↑ T.P. Dryja, E.L. Berson, V.R. Rao and D.D. Oprian Nat. Genet. 4 (1993), pp. 280–283.
  29. ↑ P.A. Sieving, J.E. Richards, F. Naarendorp, E.L. Bingham, K. Scott and M. Alpern Proc. Natl. Acad. Sci. USA 92 (1995), pp. 880–884.

External links[edit | edit source]

Classification
External resources


WikiMD
Navigation: Wellness - Encyclopedia - Health topics - Disease Index‏‎ - Drugs - World Directory - Gray's Anatomy - Keto diet - Recipes

Search WikiMD

Ad.Tired of being Overweight? Try W8MD's physician weight loss program.
Semaglutide (Ozempic / Wegovy and Tirzepatide (Mounjaro / Zepbound) available.
Advertise on WikiMD

WikiMD's Wellness Encyclopedia

Let Food Be Thy Medicine
Medicine Thy Food - Hippocrates

Medical Disclaimer: WikiMD is not a substitute for professional medical advice. The information on WikiMD is provided as an information resource only, may be incorrect, outdated or misleading, and is not to be used or relied on for any diagnostic or treatment purposes. Please consult your health care provider before making any healthcare decisions or for guidance about a specific medical condition. WikiMD expressly disclaims responsibility, and shall have no liability, for any damages, loss, injury, or liability whatsoever suffered as a result of your reliance on the information contained in this site. By visiting this site you agree to the foregoing terms and conditions, which may from time to time be changed or supplemented by WikiMD. If you do not agree to the foregoing terms and conditions, you should not enter or use this site. See full disclaimer.
Credits:Most images are courtesy of Wikimedia commons, and templates Wikipedia, licensed under CC BY SA or similar.

Retrieved from "https://wikimd.com/w/index.php?title=Congenital_stationary_night_blindness&oldid=5202086"

Contributors: Prab R. Tumpati, MD