Encyclopedia-of-medicine-N
From WikiMD's Food, Medicine & Wellness Encyclopedia
- N acylaminoacyl peptide hydrolase gene
- N all trans (4 methoxyphenyl)retinamide
- N butyl n (4 hydroxybutyl) nitrosamine
- N butylbiguanide hcl
- N de ocampo
- N dihydro galacto chitosan
- N dimethylarginine
- N formylmethionine aminopeptidase
- N formylpeptide receptor
- N glycosylation site
- N hexadecyl alcohol
- N igg antibody
- N methyl n nitroso ethylcarbamate
- N methylpurine dna glycosylase gene
- N methylpurine dna glycosylase
- N mrna
- N myc (and stat) interactor wt allele
- N myristoylation
- N myristoyltransferase 2 wt allele
- N nitroso n phenylhydroxylamine ammonium salt
- N nitroso urea
- N oxide
- N ras negative
- N terminal amino acid
- N trideuteromethyl enzalutamide
- N' hexamethylenebisacetamide
- N' methylurea
- N(epsilon)-(carboxyethyl)lysine
- N,n bianiline
- N,n dibenzyldaunorubicin
- N,n dimethylcarbamoyl chloride
- N,n ethylenethiourea
- N,n'-hexamethylenebisacetamide
- N,n-dibenzyldaunorubicin
- N,n-dimethylarginine
- N-formylmethionine aminopeptidase
- N-hexadecylphosphorylcholine
- N-methyl-11c-methylaminoisobutyric acid
- N-of-1 study
- N-substituted glycines
- N-trideuteromethyl enzalutamide
- N-wasp
- N/a-remission
- N0 (I )
- N0 (I+)
- N0 (mol )
- N0 (mol+)
- N1 dlbcl
- N1,n11-bis(ethyl)norspermine
- N1bi
- N1bii
- N1biii
- N1biv
- N1mi
- N1n14 diethylhomospermine
- N1slptst
- N2 latency
- N2slptst
- N3slptst
- N5 (aminocarbonyl) l ornithine
- N6l
- N75lat
- NAACLS
- NAPCRG
- NAvigation
- NCA
- NCTMB
- NGU
- NKC
- NKF
- NOTE
- NOX
- NPC
- NPSA
- NRAEMT
- NREMR
- NREMT
- NT
- NURE
- NYHA
- Na 17/mage 3.A2/ny eso 1 peptide vaccine
- Na+/k+ transporting atpase interacting 2 gene
- Na17 a
- Na17 peptide (amino acid sequence vlpdvfircv)
- Na17.A2
- Naaccr terminology
- Naanaag
- Nab paclitaxel carboplatin pembrolizumab regimen
- Nab paclitaxel cisplatin pembrolizumab regimen
- Nab pc regimen
- Nab thiocolchicine dimer
- Nab-paclitaxel-carboplatin-pembrolizumab regimen
- Nab-paclitaxel-cisplatin-pembrolizumab regimen
- Nab-pc regimen
- Nab-thiocolchicine dimer
- Nabalus
- Nablus
- Nabothian
- Nabtc
- Nabtt
- Nabumetone/en
- Nacho chicken casserole
- Nacho steak skillet
- Nacho
- Nacreous cloud
- Nad specific malate dehydrogenase
- Nad+
- Nad-binding fold
- Nad-specific malate dehydrogenase
- Nadh coq reductase (complex I) deficiency
- Nadh dependent methemoglobin reductase deficiency
- Nadh-dependent methemoglobin reductase deficiency
- Nadolol
- Nadp inhibitors
- Naegleria
- Naepaine
- Nafcillin
- Naferon
- Nafld fibrosis score
- Nafoxidine
- Nagano
- Nagasexr
- Nagat
- Nagging feeling in your breast area
- Nagsd
- Naics
- Nail biting
- Nail deformities and dystrophies
- Nail diseases and problems
- Nail disorders
- Nail loss
- Nail patella syndrome
- Nail ridging
- Nail
- Nailbrush
- Nailing
- Nails
- Nairobi
- Naja
- Najjar
- Nakuruitis
- Nalline
- Naloxone hydrochloride dehydrate lotio
- Nalp4 antibody
- Naltrexone hydrochloride bupropion hydrochloride
- Naltrexone hydrochloride-bupropion hydrochloride
- Name and version
- Name of epidemic and/or pandemic
- Name/value pair
- Name
- Nameko
- Namespace entity
- Naming objects and fingers: middle
- Naming objects and fingers: pinky
- Naming objects and fingers: pointer
- Naming objects and fingers: ring
- Naming objects and fingers: thumb
- Naming objects and fingers
- Naming
- Namur
- Nana
- Nanaimo
- Nangibotide
- Nanism
- Nannizzia otae
- Nano device
- Nanoarray
- Nanocatalysts
- Nanocephalic
- Nanochannel
- Nanocis
- Nanoclays
- Nanocontainer
- Nanocrystals
- Nanocurie(s)
- Nanocurie
- Nanoemulsions
- Nanofabricate
- Nanofiber
- Nanoimprint
- Nanoliposomal ceramide
- Nanoliter
- Nanolithography
- Nanomaterial
- Nanometals
- Nanomole
- Nanoparticle based luteolin
- Nanoparticle chemical composition
- Nanoparticle complex
- Nanoparticle epirubicin
- Nanoparticle functionality
- Nanoparticle physical characterization
- Nanoparticle surface characteristic
- Nanoparticle targeted drug
- Nanoparticle topology
- Nanoparticle-based luteolin
- Nanoplastics
- Nanoplatin
- Nanorod
- Nanorods
- Nanos homolog 3 (drosophila) gene
- Nanos homolog 3 (drosophila) wt allele
- Nanoscale mechanism
- Nanoscale process
- Nanoshell
- Nanosphere
- Nanotax
- Nanotherm therapy system
- Nanoxelm
- Nanticoke
- Nantua
- Nap imaging agent
- Nap22, rat, homolog of gene
- Napbc
- Napery
- Naphazoline
- Naphthalenesulfonic
- Naphtho(1,2,3,4,def)chrysene
- Naphtholsulfonic
- Naphthoquinone
- Naphthyl
- Napolitaine
- Naprapath
- Naproxen/en
- Napsylate
- Naranjo scale
- Naratriptan
- Narceine
- Narcissistic personality disorder npd
- Narcissistic personality disorder
- Narcissistic
- Narcoanalysis
- Narcoanesthesia
- Narcodiagnosis
- Narcohypnosis
- Narcolepsy
- Narcomania
- Narcose
- Narcosuggestion
- Narcotan
- Narcotherapy
- Narcoticism
- Narcotine
- Narcotism
- Narcotization
- Narcotoline
- Narrative appeal
- Narrow bantu language
- Narrow column of contrast or air between tb and pw
- Narrow spectrum
- Narrow therapeutic indices
- Narrow
- Narrowed filtration angle
- Narrowing of the bile ducts due to aids
- Narrowing
- Narthex
- Nas/iom
- Nasal applicator
- Nasal cancer
- Nasal cavity and paranasal sinus adenocarcinoma
- Nasal cavity and paranasal sinus nut carcinoma
- Nasal cavity and paranasal sinuses
- Nasal cavity exophytic schneiderian papilloma
- Nasal cavity extranodal nk/t cell lymphoma
- Nasal cavity schneiderian papilloma, inverted type
- Nasal cavity schneiderian papilloma
- Nasal congestion and discharge
- Nasal congestion and rhinorrhea
- Nasal drops, emulsion
- Nasal drops, lyophilisate for suspension
- Nasal drops, powder and solvent for solution
- Nasal drops, powder for solution
- Nasal drops, solution in single-dose container
- Nasal drops, solution
- Nasal drops, suspension
- Nasal foreign bodies
- Nasal inhaler dose form
- Nasal lateral wall
- Nasal polyps
- Nasal powder in single dose container
- Nasal powder in single-dose container
- Nasal saline wash
- Nasal soft tissue
- Nasal spray, emulsion
- Nasal spray, lyophilisate for suspension
- Nasal spray, powder for solution
- Nasal spray, solution in single-dose container
- Nasal spray, solution/oromucosal solution
- Nasal spray, solution
- Nasal spray, suspension
- Nasal turbinate, dorsal concha
- Nasal turbinate, ethmoidal concha
- Nasal turbinate, middle concha
- Nasal turbinate, ventral concha
- Nasal type extranodal nk/t cell lymphoma
- Nasal/oromucosal solution
- Nasal/oromucosal spray, solution
- Nasal
- Nasalis
- Nash test
- Nash
- Nasion
- Nasmyth
- Nasoalveolar
- Nasobasilar
- Nasociliary
- Nasofrontal
- Nasogastric or intestinal intubation
- Nasogastric tube placement and feeding pediatric
- Nasogastric
- Nasolabial
- Nasolacrimal drainage system involvement (+/
- Nasolacrimal
- Nasomaxillary
- Nasopalatine
- Nasopharyngeal adenoid cystic carcinoma
- Nasopharyngeal biopsy
- Nasopharyngeal cancer pm0 tnm finding
- Nasopharyngeal cancer
- Nasopharyngeal carcinoma by ajcc v6 stage
- Nasopharyngeal carcinoma by ajcc v7 stage
- Nasopharyngeal hodgkin lymphoma
- Nasopharyngeal keratinizing epidermoid carcinoma
- Nasopharyngeal laryngoscopy
- Nasopharyngeal lymphoma
- Nasopharyngeal neoplasm, benign
- Nasopharyngeal non hodgkin lymphoma
- Nasopharyngeal non neoplastic disorder
- Nasopharyngeal pituitary gland adenoma
- Nasopharyngeal squamous cell carcinoma
- Nasopharyngeal swab test
- Nasopharyngeal teratoid polyp
- Nasopharyngeal throat nonkeratinizing cancer
- Nasopharyngeal throat papillary adenocarcinoma
- Nasopharyngeal wash
- Nasopharyngeal
- Nasopharyngitis
- Nasopharyngoscope
- Nasosinusitis
- Nasospinale
- Nasotracheal
- Nasotracheobronchial
- Nasoturbinate
- Nastiness
- Nat24 allele
- Natal
- Nati
- National Institute of Food and Agriculture
- National cancer burden
- National cancer institute terminology
- National coordinating investigator
- National detection research network
- National drug code gram
- National drug code milligram
- National drug code milliliter
- National drug code unit of measure
- National guard
- National park service
- National socialism
- National wilms tumor study group staging system
- National
- Nationalistic
- Nationhood
- Native antigen receptor
- Natriuretic peptide a gene
- Natriuretic peptide precursor b gene
- Natriuretic peptide receptor a/guanylate cyclase a
- Natural cytotoxicity triggering receptor 1 gene
- Natural cytotoxicity triggering receptor 2 gene
- Natural cytotoxicity triggering receptor 3 gene
- Natural cytotoxicity triggering receptor
- Natural family planning
- Natural grandchild
- Natural heart valve repair
- Natural history and cofactors
- Natural history group
- Natural human interferon beta
- Natural killer associated transcript 4 positive
- Natural killer cell activation
- Natural killer cell antigen cd94
- Natural killer cell function
- Natural killer cell granular protease
- Natural killer cell p30-related protein
- Natural killer cell p44-related protein
- Natural killer cell p46-related protein
- Natural killer cell stimulatory factor 2
- Natural killer cells cyclophilin related protein
- Natural killer t cell
- Natural killer triggering receptor gene
- Natural killer-associated transcript 4 positive
- Natural products chemistry
- Natural pruning
- Natural resources conservation
- Natural-killer cells cyclophilin-related protein
- Natural
- Naturist
- Naturopath
- Naturopathy
- Nausea and vomiting during early pregnancy
- Nausea and vomiting in adults
- Nausea and vomiting in infants and children
- Nausea and vomiting scale
- Nausea and vomiting
- Nausea frequency
- Nausea question
- Nausea scale
- Nausea severity
- Nausea
- Nauseant
- Navajo Indians
- Navel orange
- Navel
- Navelbine regimen
- Navicular
- Navy Blue
- Navy blue
- Naxe
- Nazi Germany
- Nazi Party
- Nb4 apoptosis/differentiation related protein
- Nbaf complex
- Nbd protein
- Nbd
- Nbk
- Nbmbmx
- Nbn
- Nbnl2ind
- Nbnlnum
- Nbtf
- Nc2 alpha
- Nc2 beta
- Ncab
- Ncadherin staining method
- Ncam1 expressing cell measurement
- Ncbaf
- Ncbi taxon id
- Nccf
- Nccn cytogenetic risk group for all, good risk
- Nccn cytogenetic risk group for all, poor risk
- Nccn cytogenetic risk group for all
- Nccn distress thermometer
- Nccr
- Ncgm
- Nci initial review group
- Nci ln1
- Nci ln2
- Nci ln3
- Nci meta cui
- Nci office of the director
- Nci organization
- Nci program (t, p, or n)
- Nci special emphasis panel
- Nci strategic plan to reduce health disparities
- Nci thesaurus entity
- Nci thesaurus kind
- Nci tissue expediter
- Ncic ctg
- Ncic
- Ncicb
- Nciprogramcode
- Ncit covid 19 agent terminology
- Ncit covid 19 terminology
- Nck2
- Nckipsd
- Ncmh
- Ncoa 5
- Ncorp
- Ncov antibody
- Ncov igm positive
- Ncov positive
- Ncov
- Ncpb
- Ncpdp doseunitofmeasure terminology
- Ncpdp quantityunitofmeasure terminology
- Ncpdp strengthform terminology
- Ncpdp terminology
- Ncr of multiple myeloma or plasma cell leukemia
- Ncrna seq (sequencing of non coding rna)
- Ncrna-seq (sequencing of non-coding rna)
- Ncstn protein variant
- Ncstn
- Nctd5p
- Ncvaltyp
- Ncym protein
- Nda authorized generic
- Ndba
- Ndc80, kinetochore complex component gene
- Ndea
- Ndela
- Ndf rt
- Ndf-rt
- Ndfrt code
- Ndfrt name
- Ndii
- Ndls
- Ndmtase
- Ndnc8 exon 73 mutation
- Ndnc8 gene mutation
- Ndor1
- Ndpa
- Ndrg1
- Ndri
- Neapolitan fat bombs
- Neapolitan mastiff
- Near diploid
- Near haploid
- Near infrared fluorescence imaging probe
- Near infrared imaging
- Near term infant
- Near-haploid
- Near-infrared imaging
- Near
- Nearly all the time
- Nearly daily
- Nearly every day for 2 weeks
- Nearly everyday
- Nearthrosis
- Nebivolol/en
- Nebivolol
- Nebuchadnezzar II
- Nebule
- Nebulisation solution
- Nebulisation use
- Nebuliser dispersion
- Nebulization
- Nebulizer
- Nec
- Necator
- Necatoriasis
- Necdin, melanoma antigen (mage) family member gene
- Neck and back pain
- Neck and low back pain
- Neck arthritis
- Neck computed tomography with contrast
- Neck ct with contrast
- Neck cup
- Neck edema
- Neck exercises
- Neck injuries and disorders
- Neck lump
- Neck lumps in children
- Neck lymph node boundary level iii
- Neck lymph node boundary level iv
- Neck lymph node boundary level vi
- Neck lymph node boundary level vii
- Neck lymph node boundary sublevel ia
- Neck lymph node boundary sublevel ib
- Neck lymph node boundary sublevel iia
- Neck lymph node boundary sublevel iib
- Neck lymph node boundary sublevel va
- Neck lymph node boundary sublevel vb
- Neck lymph node groups
- Neck lymph node levels I iv
- Neck lymph node levels I-iv
- Neck lymph node levels ii iv
- Neck lymph node levels ii-iv
- Neck mass
- Neck masses in children
- Neck mri with and without contrast
- Neck of the bladder
- Neck of the humerus, anatomical
- Neck pain visual analog scale
- Neck pain
- Neck
- Neckcir
- Necked
- Necml
- Necro/sis
- Necrobacillosis
- Necrobiosis
- Necrobiotic
- Necrogenic
- Necrolysis
- Necromantic
- Necromass
- Necrophile
- Necrophiliac
- Necrophobe
- Necrophobia
- Necropsy sample
- Necrose
- Necrosin
- Necrosis (y/n)
- Necrosis factor (TNF)
- Necrosis induction
- Necrosis/degeneration
- Necrosis/infiltrate
- Necrosis/inflammation
- Necrosis
- Necrospermia
- Necrotic uveal melanoma
- Necrotic
- Necrotizing deciduitis
- Necrotizing enterocolitis nec
- Necrotizing enterocolitis neonatal
- Necrotizing enterocolitis
- Necrotizing gastritis
- Necrotizing skin infections
- Necrotizing soft tissue infection
- Necrotizing
- Necrotomy
- Necrotoxin
- Nectin cell adhesion molecule 2 gene
- Nectin cell adhesion molecule 4 gene
- Necturus
- Nedd4 binding protein 2 gene
- Nedd4 binding protein 2 wt allele
- Nedd8 activating enzyme e1 subunit 1 gene
- Nedocromil
- Nee
- Need to be near a bathroom always
- Need to be near a bathroom most of the time
- Need to urinate frequently during the day
- Need
- Needle applicator
- Needle biopsy of the pleura or lung
- Needle free injection dosing unit
- Needle free injection
- Needle free injector
- Needle gauge
- Needle stick prevention mechanism
- Needle stick/puncture
- Needle sticks hurt
- Needle tract lesion
- Needle-free injector
- Needle
- Needs help (verbal, physical, carrying aid)
- Needs help with personal care
- Needs help with wheelchair transfer
- Needs help, but can do about half unaided
- Needs intensive care, seriously ill, moribund
- Needs some help, but can do something alone
- Neelsen
- Neencephalon
- Nefertiti
- Negationindicator
- Negationreason
- Negative breast carcinoma
- Negative cell selection
- Negative circumferential margin by mri
- Negative cobas taqscreen mpx test
- Negative cofactor 2 alpha
- Negative contrast agent
- Negative differentiation regulator protein
- Negative elongation factor complex member b gene
- Negative elongation factor complex member c/d gene
- Negative elongation factor complex member e gene
- Negative elongation factor protein b
- Negative for gastric intraepithelial neoplasia
- Negative for malignancy/normal/benign
- Negative for neoplasia
- Negative infinity
- Negative integer value
- Negative pregnancy test
- Negative pressure wound therapy
- Negative regulation of cell proliferation
- Negative schumm's test
- Negative sense, single-stranded RNA viruses
- Negative skin test
- Negative small cell sarcoma
- Negative
- Negatively charged
- Negativistic
- Negativity scale score
- Negativity
- Neglect in older adults
- Neglect
- Negri
- Negro Pepper
- Nehi
- Nei endonuclease viii-like 3 (e. Coli) gene
- Nei-like dna glycosylase 1 gene
- Neigh
- Neighborhood disadvantage
- Neighbors or groups
- Neisseria elongata subsp. Nitroreducens
- Neisseria gonorrhoeae measurement
- Neisseria gonorrhoeae, beta-lactamase negative
- Neisseria gonorrhoeae, beta-lactamase positive
- Neisseria gonorrhoeae, penicillinase negative
- Neisseria gonorrhoeae, penicillinase positive
- Neisseria
- Neisseriaceae
- Neisserian
- Neither good or bad
- Nelfinavir
- Nell Gwynne
- Nemathelminth
- Nemathelminthes
- Nematocidal
- Nematocide
- Nematoda
- Nematode
- Nematodes roundworms
- Nematodes
- Nematodiasis
- Nematodiriasis
- Nematodirus
- Nematologist
- Nematomorpha
- Nembutalized
- Nemic
- Nemo like kinase gene
- Nenets
- Neo-Darwinism
- Neo-Lamarckism
- Neo-adjuvant
- Neo-antigen peptide
- Neo-masct
- Neoangiogenesis
- Neoantigen peptide antibody
- Neoantigen positive malignant solid tumor
- Neoantigen positive
- Neoantigen-positive malignant solid tumor
- Neoarsphenamine
- Neob
- Neoblastic
- Neocerebellar
- Neocerebellum
- Neocinchophen
- Neocosmospora solani
- Neoepitope based immunotherapeutic adxs neo
- Neoepitope-based immunotherapeutic adxs-neo
- Neoformation
- Neogenetic
- Neogenin 1 gene
- Neogenin homolog 1 (chicken) gene
- Neogenin homolog 1
- Neohesperidin
- Neointima
- Neomorph
- Neomycin a
- Neomycin b sulphate
- Neomycin resistance gene
- Neonat/e
- Neonatal abstinence syndrome assessment result
- Neonatal adverse event
- Neonatal bacterial meningitis
- Neonatal birth injury
- Neonatal bradyarrhythmia
- Neonatal breast enlargement
- Neonatal cholestasis
- Neonatal coagulation disorder, adverse event
- Neonatal complications
- Neonatal conjunctivitis
- Neonatal constipation, adverse event
- Neonatal convulsion
- Neonatal culture negative sepsis, adverse event
- Neonatal culture positive sepsis, adverse event
- Neonatal death level of diagnostic certainty
- Neonatal diarrhea, adverse event
- Neonatal edema, adverse event
- Neonatal epileptic seizure
- Neonatal fever, adverse event
- Neonatal gasping syndrome
- Neonatal gastrointestinal bleeding, adverse event
- Neonatal hepatitis b virus hbv infection
- Neonatal herpes simplex virus hsv infection
- Neonatal hie
- Neonatal hospital acquired infection
- Neonatal hyperbilirubinemia
- Neonatal hypercalcemia
- Neonatal hyperglycemia
- Neonatal hypernatremia
- Neonatal hypertension, adverse event
- Neonatal hypocalcemia
- Neonatal hypoglycemia
- Neonatal hyponatremia
- Neonatal infections level of diagnostic certainty
- Neonatal intraventricular hemorrhage, adverse event
- Neonatal jaundice
- Neonatal leukemia
- Neonatal leukopenia
- Neonatal listeriosis
- Neonatal narcotic withdrawal syndrome
- Neonatal opioid withdrawal syndrome
- Neonatal pneumonia
- Neonatal pneumothorax
- Neonatal pulmonary hamartoma
- Neonatal respiratory insufficiency
- Neonatal resuscitation
- Neonatal seizure disorders
- Neonatal sepsis
- Neonatal sinus bradycardia
- Neonatal sinus tachycardia
- Neonatal spells
- Neonatal spontaneous intestinal perforation
- Neonatal tachyarrhythmia
- Neonatal
- Neonate
- Neonates
- Neonatologist
- Neonicotinoid insecticides
- Neopallial
- Neopallium
- Neophobia
- Neopine
- Neoplas/ia
- Neoplasia
- Neoplasias
- Neoplasm antigens
- Neoplasm progression
- Neoplasm proteins
- Neoplasm, uncertain whether benign or malignant
- Neoplasms, cerebellar, benign
- Neoplasms, infratentorial
- Neoplasms
- Neoplastic Conversion
- Neoplastic cell transformation
- Neoplastic eosinophilic spindle cell
- Neoplastic nodule
- Neoplastic plasma cells present in bone marrow
- Neoplastic polyp
- Neoplastic status
- Neosho
- Neostriatum
- Neotcr-p1 t-cells
- Neothalamus
- Neovascular
- Neovascularization
- Neovasculature
- Neovax melanoma vaccine
- Neovax renal cell carcinoma vaccine
- Neoviderm
- Nepetalactone
- Nephelium
- Nephelometry
- Nephralgia
- Nephrectomize
- Nephritic
- Nephritis
- Nephritogenic
- Nephroblastoma, benign
- Nephrocalcinosis
- Nephrocapsectomy
- Nephrocoel
- Nephrocystin-7 gene
- Nephrogenesis
- Nephrogenic diabetes insipidus
- Nephrogenic ridge
- Nephrogenic
- Nephrogram
- Nephrography
- Nephrolithiasis
- Nephrolithotomy
- Nephrologist
- Nephrolysis
- Nephroma
- Nephromere
- Nephronophthisis 1 (juvenile) gene
- Nephronophthisis
- Nephropathies
- Nephropathy
- Nephropexy
- Nephroprotective agents
- Nephroptosis
- Nephrorrhaphy
- Nephrosclerosis
- Nephroscope
- Nephrostogram
- Nephrostomy
- Nephrotic syndrome - glepp1 associated
- Nephrotic syndrome
- Nephrotic
- Nephrotome
- Nephrotomogram
- Nephrotomography
- Nephrotomy
- Nephrotoxin
- Nephroureterectomy with cuff of bladder
- Nepidae
- Neprilysin antibody
- Neprilysin expressing cell count
- Nerlynx capecitabine
- Nerlynx regimen
- Nerlynx-capecitabine
- Nernst
- Nerofe
- Nerve and muscle biopsy
- Nerve cell survival
- Nerve chemical warfare agents
- Nerve growth factor (beta polypeptide) gene
- Nerve growth factor (beta polypeptide) wt allele
- Nerve growth factor mimetic
- Nerve root disorders
- Nerve sheath tumor, not otherwise specified
- Nerve sparing surgery
- Nerve tissue and nerve sheaths
- Nerve(s) cranial
- Nerve, caudal plexus
- Nerve, fibular
- Nerve, median
- Nerve, peroneal, common
- Nerve, peroneal, deep
- Nerve, peroneal, superficial
- Nerve, plantar
- Nerve, saphenous
- Nerve, sural
- Nerve, tibial
- Nerve
- Nerves
- Nervi
- Nervine
- Nerving
- Nervon
- Nervonic
- Nervosa
- Nervous system findings
- Nervous system fluids and secretions
- Nervous system neoplasm, benign
- Nervous system neoplasms, malignant
- Nervous system, brain
- Nervous system, ear
- Nervous system, eye
- Nervous system-fluids, secretions
- Nervous
- Nervus
- Nesol
- Nesselrode Pudding
- Nesselrode pudding
- Nesselrode
- Nessler
- Nesslerize
- Nested case control study
- Nested proliferation
- Nestedness
- Nestin gene
- Nestin wt allele
- Nestlings
- Nestmate recognition
- Net ecosystem exchange
- Net ecosystem production
- Net farm income
- Net head
- Nether region
- Netherworld
- Neti
- Netrin 1 gene
- Netrin 1 homolog
- Netrin 1, mouse, homolog of gene
- Netrin g1 gene
- Network communication problem
- Network endpoint
- Network interface
- Neu areas brain
- Neu arteries brain
- Neu autonomic nervous system labels
- Neu autonomic nervous system
- Neu basal ganglia
- Neu brain activity normal
- Neu brain activity seizure a
- Neu brain activity seizure b
- Neu brain damage
- Neu brain herniation
- Neu brain lobes pv
- Neu brain move muscle periph
- Neu bursts breaks stroke
- Neu cauda equina
- Neu clots clogs stroke
- Neu cranial nerves
- Neu cutaneous nerve lower
- Neu cutaneous nerve upper
- Neu dermatomes
- Neu homunculus
- Neu hyperkinesias
- Neu insulating nerve ms
- Neu low expressing
- Neu lumbar puncture
- Neu mallampati snoring sketch
- Neu metoclopramide
- Neu negative by fish
- Neu negative by immunohistochemistry
- Neu nerve cell
- Neu neurotransmission
- Neu pain scales
- Neu plexuses pe
- Neu plexuses periph
- Neu positive by fish
- Neu positive by immunohistochemistry
- Neu referred pain
- Neu reflex arc
- Neu sleep pattern
- Neu sleep stages
- Neu spinal cord damage ai resize
- Neu spinal nerve updated eb
- Neu spine organized a
- Neu spine organized b qf
- Neu spine organized b
- Neu status by validated dual probe ish
- Neu status by validated single probe ish
- Neu strokes one side
- Neu supplying brain blood stroke
- Neu taking pressure off nerve cranial
- Neu testing by validated immunohistochemistry
- Neu to from spinal cord a
- Neu to from spinal cord b
- Neu viewing the brain a
- Neu viewing the brain b
- Neu-metoclopramide
- Neu
- Neulasta regimen
- Neumune
- Neupogen regimen
- Neural Synapse
- Neural cell adhesion molecule 1 gene
- Neural cell adhesion molecule 1 negative
- Neural cell adhesion molecule 1 positive
- Neural cell adhesion molecule 1 wt allele
- Neural cell adhesion molecule 2 gene
- Neural cell adhesion molecule 2 wt allele
- Neural crest tumor, benign
- Neural drug delivery systems
- Neural egfl like 1 gene
- Neural egfl like 1 wt allele
- Neural endopeptidase induced membranous nephropathy
- Neural growth/development/degeneration
- Neural networks (computer)
- Neural nevus
- Neural peptide receptor
- Neural tube defects and spina bifida
- Neural tube defects ntds
- Neural zinc finger transcription factor 1 gene
- Neural
- Neuralgia
- Neuralgiform
- Neuralized e3 ubiquitin protein ligase 1 gene
- Neuraminic
- Neuraminidase inhibition assay
- Neurapraxia
- Neurasthenic
- Neuraxial opioid analgesia
- Neuraxon
- Neurectoderm
- Neurectomy
- Neuregulin 1 gene
- Neuregulin 2 gene
- Neuregulin 2 wt allele
- Neuregulin 3 gene
- Neuregulin positive
- Neurenteric
- Neurergic
- Neurexin 1 alpha
- Neurexin 1 gene
- Neurexin 1 isoform 1b
- Neurexin 2 gene
- Neurexin 2 wt allele
- Neurexin 3 gene
- Neurexin 3 wt allele
- Neurexin iii-beta
- Neurexin-2 isoform 1b
- Neurexin-2-alpha
- Neurexin-3-alpha
- Neurilemmoma
- Neurility
- Neurine
- Neurite
- Neuritis
- Neuro oncologic ventral antigen 2 gene
- Neuro oncological ventral antigen 1 gene
- Neuro oncology
- Neuro ophthalmologic and cranial nerve disorders
- Neuro ophthalmology
- Neuro otology
- Neuro qol adult self reported mental health domain
- Neuro qol cognitive function subdomain
- Neuro qol
- Neuro trauma icu stay
- Neuro-d4, rat, homolog of gene
- Neuro-oncologic ventral antigen 2 gene
- Neuro-oncological ventral antigen 1 gene
- Neuro-qol
- Neuro-trauma icu stay
- Neuro
- Neuroanatomist
- Neuroaugmentation techniques
- Neurobeachin gene
- Neurobeachin wt allele
- Neurobehavioral
- Neurobiofeedback
- Neurobiologist
- Neurobiotaxis
- Neuroblast
- Neuroblastoma amplified protein
- Neuroblastoma amplified sequence gene
- Neuroblastoma of the retina
- Neuroblastoma ras viral oncogene homolog
- Neuroblastoma risk group
- Neuroblastoma screening
- Neuroblastoma
- Neuroborreliosis
- Neurocentrum
- Neurochemist
- Neurocirculatory
- Neurocoele
- Neurocognitive assessment
- Neurocognitive disturbance
- Neurocognitive
- Neurocranium
- Neurocutaneous melanocytosis
- Neurocutaneous syndromes in children
- Neurocutaneous syndromes
- Neurocutaneous
- Neurocysticercosis
- Neurocyte
- Neurocytology
- Neurocytolysin
- Neurocytoma
- Neurod1-associated monogenic diabetes
- Neurodermatitic
- Neurodermatitis
- Neurodermatosis
- Neurodevelopment
- Neurodiagnostic
- Neurodynamic
- Neuroectoderm
- Neuroectodermal cell
- Neuroeffector
- Neuroelectric
- Neuroembryologist
- Neuroembryology
- Neuroendocrine carcinoma of the ampullary region
- Neuroendocrine carcinoma, excluding head and neck
- Neuroendocrine carcinoma, nos
- Neuroendocrine cell tumor, benign
- Neuroendocrine cell tumor, malignant
- Neuroendocrine neoplasm of the ampullary region
- Neuroendocrine tumor g1 of the ampullary region
- Neuroendocrine tumor g2 of the ampullary region
- Neuroendocrine tumor of the ampullary region
- Neuroendocrine tumor, well differentiated
- Neuroendocrinologist
- Neuroengineering
- Neuroepithelial tissue
- Neuroepithelial
- Neuroepithelioma
- Neuroepithelium
- Neurofeedback
- Neurofibroma of spinal cord
- Neurofibromatosis aggravated
- Neurofibromatosis, nos
- Neurofibromatosis
- Neurofibromin 1 c.4394a g
- Neurofibromin 1 c.6926del
- Neurofibromin 1 gene deletion
- Neurofibromin 1 gene mutation
- Neurofibromin 1 gene
- Neurofibromin 1 mutation analysis
- Neurofibromin 2 gene
- Neurofibromin gene rearrangement
- Neurofibromin n1465s
- Neurofibromin positive
- Neurofibromin protein variant
- Neurofibrosarcoma
- Neurofilament h
- Neurofilament l
- Neurofilament light gene
- Neurofilament m
- Neurofilament, heavy polypeptide gene
- Neurofilament, heavy polypeptide wt allele
- Neurofilament, medium polypeptide gene
- Neurofilament, medium polypeptide wt allele
- Neurofilament
- Neurogen
- Neurogenesis
- Neurogeneticist
- Neurogenetics
- Neurogenic appendicopathy
- Neurogenic arthropathy
- Neurogenic bladder
- Neurogenic differentiation 1 gene
- Neurogenic
- Neurogenin 1 gene
- Neuroglandular
- Neuroglial heterotopia
- Neurogram
- Neurography
- Neurohistologist
- Neurohistology
- Neurohypophyseal
- Neuroid
- Neuroimmunology
- Neurojungin
- Neurokeratin
- Neurokyme
- Neuroleptanalgesia
- Neuroleptic malignant syndrome
- Neuroleptic
- Neuroligin 4, x linked gene
- Neurolin
- Neurolinguistics
- Neurologic disorders in children
- Neurologic disorders
- Neurologic examination
- Neurologic process
- Neurologic tests and procedures
- Neurologic
- Neurological model
- Neurological signs and symptoms
- Neurological
- Neurology other
- Neurology, pediatric
- Neurolymphomatosis
- Neurolysis
- Neurolytic
- Neuroma
- Neuromalacia
- Neuromechanism
- Neuromedin b gene
- Neuromedin b preferring bombesin receptor
- Neuromedin b receptor gene
- Neuromedin b wt allele
- Neuromedin c gene
- Neuromedin c
- Neuromedin u gene
- Neuromedin-beta
- Neuromelanin
- Neuromere
- Neurometrics
- Neuromimesis
- Neuromodulator
- Neuromotor
- Neuromuscular
- Neuromyelitis optica nmo
- Neuromyelitis optica spectrum disorder nmosd
- Neuromyelitis
- Neuromyoblastoma, malignant
- Neuromyopathy
- Neuromyositis
- Neuron conduction induction
- Neuron-specific enolase measurement
- Neuron-specific enolase negative
- Neuron-specific enolase positive
- Neuron
- Neuronal cell adhesion molecule gene
- Neuronal ceroid lipofuscinosis, parry type
- Neuronal gene
- Neuronal growth
- Neuronal krueppel like protein
- Neuronal krueppel-like protein
- Neuronal nicotinic receptor beta 4 subunit gene
- Neuronal nicotinic receptor beta 4 subunit
- Neuronal tissue enriched acidic protein
- Neuronal tissue-enriched acidic protein
- Neuroneuronal
- Neuronevus
- Neuronitis
- Neuronography
- Neuronophagia
- Neuronotropic
- Neurooncologic ventral antigen 2 gene
- Neurooncological ventral antigen 2
- Neuroparalytic
- Neuropath
- Neuropathic pain
- Neuropathic
- Neuropathies
- Neuropathogenesis
- Neuropathogenic
- Neuropathologist
- Neuropathy
- Neuropeptide precursor gene
- Neuropeptide y gene
- Neuropeptide y receptor y1 gene
- Neuropeptide y receptor y1 wt allele
- Neuropeptide y receptor y2 gene
- Neuropeptide y receptor y2 wt allele
- Neuropeptide y receptor y5 gene
- Neuropeptide y receptor y5 wt allele
- Neuropeptide
- Neuropharmaceutical
- Neuropharmacologist
- Neuropharmacology / toxicology
- Neurophysin
- Neurophysiologist
- Neurophysiology / electrophysiology
- Neuropil
- Neuropilin 1 gene
- Neuropilin 2 gene
- Neuroplasm
- Neuroplastic
- Neuroplegic
- Neuropodium
- Neuropoietic cytokine
- Neuropore
- Neuroprotectant
- Neuroprotective drugs
- Neuropsychiatric inventory questionnaire
- Neuropsychiatric inventory-questionnaire
- Neuropsychiatrist
- Neuropsychic
- Neuropsychological examination
- Neuropsychological problems
- Neuropsychologist
- Neuropsychopharmacology
- Neuropsychotoxicology
- Neuroradiologist
- Neurorelapse
- Neuroretinitis
- Neurorrhaphy
- Neuroscience nursing
- Neurosciences research
- Neuroscientist
- Neurosensory disorder
- Neurosome
- Neurostimulator
- Neurosurgeon
- Neurosurgery/en
- Neurosurgery
- Neurosyphilis
- Neurosyphilitic
- Neurotendinous
- Neurotensin gene
- Neurotensin receptor 1 gene
- Neurotensin receptor 1 wt allele
- Neurotensin receptor type 1 positive
- Neurotensin wt allele
- Neurotensin
- Neurotherapy
- Neurotogenic
- Neurotomy
- Neurotoxic chemotherapy
- Neurotoxic
- Neurotoxicologist
- Neurotoxicology
- Neurotransmission
- Neurotrauma
- Neurotrope
- Neurotrophic receptor tyrosine kinase 1 gene
- Neurotrophic receptor tyrosine kinase 3 gene
- Neurotrophic tyrosine kinase receptor 2 gene
- Neurotrophic
- Neurotrophin 3 gene
- Neurotrophin 3 wt allele
- Neurotropism
- Neurotubule
- Neurovaccine
- Neurovaccinia
- Neurovascular disorder
- Neurovascular
- Neurovegetative
- Neurovirology
- Neurovirulence
- Neurovisceral
- Neurturin gene
- Neutagr
- Neutcybs
- Neutered indicator
- Neuthygr
- Neutimle
- Neutls
- Neutral fetal attitude
- Neutral oil
- Neutral
- Neutralizing anti drug antibodies
- Neutralizing anti-drug antibodies
- Neutralizing antibodies
- Neutralizing binding antidrug antibody
- Neutralizing g17 hormone
- Neutroclusion
- Neutrogin
- Neutropenia attenuation
- Neutropenia
- Neutrophil activation
- Neutrophil adherence receptor alpha-m subunit
- Neutrophil azurocidin gene
- Neutrophil count 1000 per cubic millimeter
- Neutrophil count 500 per cubic millimeter
- Neutrophil count decreased
- Neutrophil cytoplasmic ab, atypical
- Neutrophil cytoplasmic ab, classic
- Neutrophil cytosolic factor 2 gene
- Neutrophil elastase, polymorphonuclear
- Neutrophil expressed gene
- Neutrophil rich hepatocellular carcinoma
- Neutrophil/cd4+ lymphocyte ratio
- Neutrophilia
- Neutrophilic leukocytosis
- Neutrophilic toxic change
- Neutrophilic
- Neutrophils band form/ neutrophils
- Neutrophils band form/leukocytes
- Neutrophils, segmented + band form + precursors
- Neutrophils, segmented + band form
- Neutrophils, segmented/leukocytes
- Neutrophils, segmented/neutrophils
- Neutrophils/leukocytes
- Neutrophils/lymphocytes
- Neutrophils/non-squam epi cells
- Neutrophils/total cells
- Never affects sleep
- Never dosed
- Never marketed
- Never married status
- Never used
- Nevocarcinoma
- Nevoid cutaneous (skin) melanoma
- Nevoid
- Nevus araneus
- Nevus of acral skin
- Nevus of flexural skin
- Nevus of head and neck
- Nevus of the breast
- Nevus of the conjunctiva
- Nevus of the eyelid
- Nevus of the iris
- Nevus syringoadenomatosus papilliferum
- Nevus with dermal epithelioid component
- Nevus
- New England clam chowder
- New England region
- New Englander
- New Haven
- New Zealand spinach
- New active ingredient
- New animal drug application
- New anterior wall myocardial infarction
- New anterolateral wall myocardial infarction
- New anteroseptal wall myocardial infarction
- New bone lesion
- New component of brcaa1 a complex gene
- New component of the brcaa1 a complex
- New edition
- New event after initial treatment
- New extensive anterior wall myocardial infarction
- New guinean
- New high lateral wall myocardial infarction
- New index
- New inferior wall myocardial infarction
- New lateral wall myocardial infarction
- New lesion
- New loss of viable myocardium
- New myocardial infarction by ekg finding
- New non measurable lesion
- New non-index
- New objective column
- New or unknown interferent
- New or worsening symptoms
- New prevention strategies against disease
- New primary tumor, specify
- New regional wall motion abnormality
- New reservoir
- New septal wall myocardial infarction
- New tumor additional surgery date
- New tumor additional surgery performed
- New tumor confirmed
- New tumor event after initial treatment
- New tumor event date
- New tumor event
- New york strip
- New zealand hybrid
- New
- Newace
- Newari
- Newbie
- Newborn screening terminology
- Newborn screening tests
- Newborn screening
- Newborn
- Newborns
- Newby
- Newcastle-upon-Tyne
- Newlind
- Newlprog
- Newlwind
- Newqwave
- News agency
- News item
- News list
- News104a
- News2 clinical classification question
- News
- Newsboy
- Newspaper article
- Newsstand
- Newswoman
- Newton
- Nexus junction
- Nf l
- Nf m
- Nf1 mutant mpnst
- Nf1 mutational analysis performed
- Nf1 mutational analysis testing method
- Nf1 tumor suppressor gene inactivation
- Nf2 tumor suppressor gene inactivation
- Nfbd1 gene mutation
- Nfe1 exon 2 mutation
- Nfe1 exon 3 mutation
- Nfe1 gene mutation
- Nfe1b gene mutation
- Nfe1b
- Nfkbid
- Nfkbiz
- Ng/dl
- Ng/ml/(kg/m2)
- Ng/ml/(mg/cm2)
- Ng/ml/(ug/kg)
- Ng/ml/(ug/kg/d)
- Ng/ml/g
- Ng/ml/h
- Ng/ml/ug
- Ng/well
- Ngap-like protein
- Ngeq/l
- Ngeq/ml/mgeq
- Ngf mrd
- Ngf-mrd
- Ngfrap1
- Ngh/ml/(mg/kg/day)
- Ngobln
- Ngoblp
- Nhanes taste and smell section
- Nhej1-scid
- Nhlbi cad grade
- Nhoid
- Nhp2 ribonucleoprotein gene
- Nhpt functional test question
- Niacin deficiency
- Niacin toxicity
- Niacin
- Niagara Falls
- Nibrin gene
- Nicardipine
- Nicastrin ala572gly
- Nicastrin gene mutation
- Nicastrin gene
- Nich
- Nichd terminology
- Niche conservatism
- Nickel metabolic disorder
- Nickel method
- Nickel silver
- Nickel(ii) hydroxide
- Nickelous chloride
- Nickelous oxide
- Nicker nut
- Nicking
- Nicklaus
- Nicollea
- Nicotinamide n methyltransferase gene
- Nicotinamide n methyltransferase wt allele
- Nicotinamide n-methyltransferase gene
- Nicotinamide n-methyltransferase wt allele
- Nicotinate
- Nicotine derived nitrosamine ketone
- Nicotine metabolite ratio
- Nicotine replacement therapy agent
- Nicotine-derived nitrosamine alcohol
- Nicotine-derived nitrosamine ketone metabolite
- Nicotinism
- Nicotinuric
- Nidal
- Nidation
- Nidogen 1 gene
- Nidogen 1 wt allele
- Nidogen 1
- Nidogen 2 (osteonidogen) gene
- Nidogen 2 (osteonidogen) wt allele
- Nidularia
- Niece second degree relative
- Niemann pick disease
- Niemann pick
- Niemann
- Nifedipine/en
- Niff
- Niffy
- Nifuroxime
- Nigella sativa blackseed oil
- Night Shift
- Night sweating
- Night terrors
- Night
- Nigral
- Nigrostriatal
- Nih 3t3 cells
- Nih cgvhd consensus project response criteria
- Nih emphasis area
- Nih national research service award for individual
- Nih sla miniature swine
- Nih toolbox
- Nih, grants and contracts
- Nih
- Nihilistic
- Niid
- Niikawa-kuroki syndrome
- Nik related kinase gene
- Nikethamide
- Nilandron regimen
- Nile
- Nim ha conjugate
- Nim-ha conjugate
- Nima (never in mitosis gene a)
- Nima related kinase 1 gene
- Nima related kinase 10 gene
- Nima related kinase 2 gene
- Nima-related kinase 3 gene
- Nima-related kinase 3 wt allele
- Nimbus
- Nimodipine
- Nine hole peg test functional test test code
- Nine hole peg test functional test test name
- Nine-hole peg test functional test test code
- Nine-hole peg test functional test test name
- Ninein (gsk3b interacting protein) gene
- Ninepence
- Ninepin
- Nineties
- Ninety-nine
- Ninhydrin
- Ninlaro regimen
- Ninlaro/dexamethasone
- Ninlaro/revlimid/dexamethasone
- Ninon
- Niobrara
- Nipa palm
- Nipah
- Nipped b homolog (drosophila) gene
- Nipped b homolog (drosophila) wt allele
- Nipple discharge
- Nipple duct carcinoma
- Nipple sensation changes
- Nipple
- Nippostrongylus
- Nipride
- Nir fluorescence endoscopy
- Nir optical imaging
- Nischarin gene
- Nischarin wt allele
- Nisin
- Nissen fundoplication
- Nissen
- Nissl
- Nitabuch's fibrinoid
- Nithiamide
- Nitraphen
- Nitration of tyrosine
- Nitric acid measurement
- Nitric oxide breath test
- Nitric oxide synthase 1 (neuronal) gene
- Nitric oxide synthase 2, inducible gene
- Nitric oxide synthase 2b gene
- Nitric oxide synthase 2b wt allele
- Nitric oxide synthase 2c gene
- Nitric oxide synthase 2c wt allele
- Nitric oxide synthase 3 (endothelial cell) gene
- Nitric oxide synthase iib
- Nitric oxide synthase iic
- Nitric
- Nitridation
- Nitrilase 1 gene
- Nitrilase 1 wt allele
- Nitrites
- Nitritoid
- Nitro group
- Nitroarenes
- Nitroaromatic compounds
- Nitrobenzoic acids
- Nitrocarbol
- Nitrocefin
- Nitrofurantoin/en
- Nitrofurantoin
- Nitrofurazone
- Nitrogen mustard compound
- Nitrogen-fixing trees
- Nitrogen
- Nitroglycerin - citrate - ethanol
- Nitromersol
- Nitrometer
- Nitron
- Nitroprusside
- Nitrosamine metabolism
- Nitrosate
- Nitrosation
- Nitroso carcinogen
- Nitroso
- Nitrosoguanidine
- Nitrosourea
- Nitrosyl
- Nitrous acid, ion(1-)
- Nitroxidergic neurons
- Nitryl
- Nitzschia
- Nivolumab/ipilimumab
- Nix gene
- Nizatidine
- Nk cell-enriched allogeneic lymphocytes
- Nk-92/5.28.Z cells
- Nk3 receptor antagonist
- Nkat/l
- Nkat1 polymorphism positive
- Nkg2-a/nkg2-b/nkg2-c
- Nkg2-c-activating nk receptor
- Nkg2-d-activating nk receptor
- Nkg2a
- Nkg2c
- Nkg2d/akt-expressing cd8-positive t-cells
- Nkg2d
- Nkp44l
- Nkts
- Nkundo
- Nkx2 8
- Nkx2h
- Nkx3 1
- Nkx3a
- Nlgase
- Nli
- Nlmd
- Nlr family, apoptosis inhibitory protein gene
- Nls
- Nm 000041.2:c.388t c,526c c
- Nm 000077.4:c.151g a
- Nm 000077.4:c.152t a
- Nm 000077.4:c.247c t
- Nm 000077.4:c.248 249delacinsct
- Nm 000077.4:c.248a c
- Nm 000077.4:c.305c t
- Nm 000077.4:c.322g c
- Nm 000077.4:c.322g t
- Nm 000077.4:c.389t a
- Nm 000077.4:c.439g a
- Nm 000077.4:c.442g a
- Nm 000077.4:c.89c t
- Nm 000110.3:c.1627a g
- Nm 000141.4:c.1115c g
- Nm 000141.4:c.1124a g
- Nm 000141.4:c.1144t c
- Nm 000141.4:c.1645a c
- Nm 000141.4:c.1647t a
- Nm 000141.4:c.1647t g
- Nm 000141.4:c.1975a g
- Nm 000141.4:c.755c g
- Nm 000141.4:c.758c g
- Nm 000142.4:c.1108g t
- Nm 000142.4:c.1111a t
- Nm 000142.4:c.1118a g
- Nm 000142.4:c.1138g a
- Nm 000142.4:c.1948a g
- Nm 000142.4:c.742c t
- Nm 000142.4:c.746c g
- Nm 000516.5:c.374a g
- Nm 000516.5:c.478c t
- Nm 000516.5:c.601c a
- Nm 000516.5:c.601c t
- Nm 000516.5:c.602g a
- Nm 000516.5:c.679c g
- Nm 000516.5:c.680a g
- Nm 000516.5:c.680a t
- Nm 000518.4:c.20a t
- Nm 000518.4:c.364g a
- Nm 000518.5:c.19g a
- Nm 000795.3:c.-486 -485insc
- Nm 000795.3:c.957c t
- Nm 001098209.2:c.121a g
- Nm 001904.4:c.110c t
- Nm 001904.4:c.133t c
- Nm 001904.4:c.134c t
- Nm 002107.4:c.83a t
- Nm 002168.3:c.418c g
- Nm 002168.3:c.418c t
- Nm 002168.3:c.419g a
- Nm 002168.3:c.419g t
- Nm 002168.3:c.514a g
- Nm 002168.3:c.514a t
- Nm 002168.3:c.515 516delgginsaa
- Nm 002168.3:c.515g a
- Nm 002168.3:c.515g t
- Nm 002168.3:c.516g c
- Nm 002168.3:c.516g t
- Nm 002468.4:c.794t c
- Nm 003530.4:c.83a t
- Nm 003531.2:c.83a t
- Nm 003537.3:c.83a t
- Nm 004048.3:c.2t g
- Nm 004119.2:c.1727t g
- Nm 004119.2:c.1775t c
- Nm 004119.2:c.1775t g
- Nm 004119.2:c.1796a g
- Nm 004119.2:c.1992g a
- Nm 004119.2:c.1992g c
- Nm 004119.2:c.1992g t
- Nm 004119.2:c.2027a g
- Nm 004119.2:c.2028c a
- Nm 004119.2:c.2028c g
- Nm 004119.2:c.2039c t
- Nm 004119.2:c.2073t a
- Nm 004119.2:c.2516a g
- Nm 004119.2:c.2517t a
- Nm 004119.2:c.2525a g
- Nm 004304.4:c.3185a t
- Nm 004304.4:c.3383g c
- Nm 004304.4:c.3497t g
- Nm 004304.4:c.3509t a
- Nm 004304.4:c.3509t g
- Nm 004304.4:c.3512 3513deltcinsat
- Nm 004304.4:c.3512t a
- Nm 004304.4:c.3520t c
- Nm 004304.4:c.3520t g
- Nm 004304.4:c.3521t g
- Nm 004304.4:c.3522c a
- Nm 004304.4:c.3522c g
- Nm 004304.4:c.3575g c
- Nm 004304.4:c.3586c a
- Nm 004304.4:c.3733t a
- Nm 004304.4:c.3733t c
- Nm 004304.4:c.3735c a
- Nm 004304.4:c.3735c g
- Nm 004304.4:c.3824g a
- Nm 004972.3:c.1848 1849deltginsct
- Nm 004972.3:c.1849g t
- Nm 004972.3:c.2047a g
- Nm 004972.3:c.2624c a
- Nm 004972.3:c.2792a g
- Nm 005228.2:c.2499g t
- Nm 005228.3:c.1474a c
- Nm 005228.3:c.1476c a
- Nm 005228.3:c.1793g t
- Nm 005228.3:c.2125 2129delgaaac
- Nm 005228.3:c.2153t a
- Nm 005228.3:c.2154 2155delgginstt
- Nm 005228.3:c.2156delg
- Nm 005228.3:c.2219 2220instcccgtcgctattaaaat
- Nm 005228.3:c.2231 2232instaaaattcccgtcgctat
- Nm 005228.3:c.2232 2233insaaaattcccgtcgctatc
- Nm 005228.3:c.2234 2236delagg
- Nm 005228.3:c.2235 2249delggaattaagagaagc
- Nm 005228.3:c.2236 2237insttcccgtcgctatcaagg
- Nm 005228.3:c.2236 2253delgaattaagagaagcaaca
- Nm 005228.3:c.2239 2247delttaagagaa
- Nm 005228.3:c.2239 2256delttaagagaagcaacatct
- Nm 005228.3:c.2240 2254deltaagagaagcaacat
- Nm 005228.3:c.2254 2277deltctccgaaagccaacaaggaaatc
- Nm 005228.3:c.2283 2284insgaagccttccag
- Nm 005228.3:c.2298 2299insgccata
- Nm 005228.3:c.2302 2303inscgctggcca
- Nm 005228.3:c.2302 2303instccaggaagcct
- Nm 005228.3:c.2303 2304instgtggccag
- Nm 005228.3:c.2303g t
- Nm 005228.3:c.2307 2308insatggccagcgtggac
- Nm 005228.3:c.2307 2308insgacaacgtg
- Nm 005228.3:c.2307 2308insgccagcgtg
- Nm 005228.3:c.2307 2308instgcgtg
- Nm 005228.3:c.2308 2309insacggcg
- Nm 005228.3:c.2308 2309insccagcgtgg
- Nm 005228.3:c.2308 2309insgcagcgtgg
- Nm 005228.3:c.2308 2309insgggtcgtgg
- Nm 005228.3:c.2309 2310delacinsccagcgtggat
- Nm 005228.3:c.2309 2310insatggccagcgtgga
- Nm 005228.3:c.2310 2311insaac
- Nm 005228.3:c.2310 2311insaacccccac
- Nm 005228.3:c.2310 2311insagcgtggac
- Nm 005228.3:c.2310 2311insgcaccgtgg
- Nm 005228.3:c.2310 2311insggc
- Nm 005228.3:c.2310 2311insggggac
- Nm 005228.3:c.2310 2311insgggtta
- Nm 005228.3:c.2310 2311insggt
- Nm 005228.3:c.2311 2312insgcgtggaca
- Nm 005228.3:c.2311 2312instggccaccccca
- Nm 005228.3:c.2313 2314insaac
- Nm 005228.3:c.2315 2316insgacacaccc
- Nm 005228.3:c.2318 2319insccccca
- Nm 005228.3:c.2319 2320insaacccccac
- Nm 005228.3:c.2319 2320inscac
- Nm 005228.3:c.2319 2320insccccac
- Nm 005228.3:c.2320 2321insgcaacccccacg
- Nm 005228.3:c.2321 2322insccacgt
- Nm 005228.3:c.2322 2323inscacgtg
- Nm 005228.3:c.2374c t
- Nm 005228.3:c.2375t a
- Nm 005228.3:c.2386g a
- Nm 005228.3:c.2386g c
- Nm 005228.3:c.2389t a
- Nm 005228.3:c.2390g c
- Nm 005228.3:c.2572 2573delctinsaa
- Nm 005228.3:c.2572 2573delctinsag
- Nm 005228.3:c.2573 2574deltginsgt
- Nm 005228.3:c.323g a
- Nm 005228.3:c.787a c
- Nm 005228.3:c.865g a
- Nm 005228.3:c.866c a
- Nm 005228.3:c.866c t
- Nm 005228.3:c.Delginsccacgtg
- Nm 005228.3:c2310 2311insggcaca
- Nm 005228.4(egfr):c.2315 2320dupcccacg
- Nm 005228.5:c.2125g a
- Nm 005228.5:c.2305g t
- Nm 005228.5:c.2497t g
- Nm 005228.5:c.2500g c
- Nm 005228.5:c.2500g t
- Nm 005228.5:c.2504a t
- Nm 005228.5:c.2527g a
- Nm 005896.3:c.356g a
- Nm 005896.3:c.394 395delcginsgt
- Nm 005896.3:c.394 395delcginstc
- Nm 005896.3:c.394c a
- Nm 005896.3:c.394c g
- Nm 005896.3:c.394c t
- Nm 005896.3:c.395 396delgtinsac
- Nm 005896.3:c.395g a
- Nm 005896.3:c.395g t
- Nm 007294.3:c.68 69delag
- Nm 007294.3c.5266dupc
- Nm 022552.4:c.2711c t
- Nm 024529.4:c.1a g
- Nm 177438.2:c.5438a g
- Nm/pcb/pred/vbl/vcr
- Nm/pcb/pred/vbl
- Nm/pcb/pred/vcr
- Nma
- Nmd transcript variant
- Nmdmc
- Nmf
- Nmh
- Nmo
- Nmol/l/(kg/m2)
- Nmol/l/mg
- Nmol/l/ug
- Nmol/mgprotein
- Nmol/ml/min
- Nmol/umol/l
- Nmolbce/l
- Nmolbce/mmol
- Nmolbce/nmol
- Nmolh/mg/ml
- Nmolh/umol/l
- Nmor
- Nmosd
- Nmt2
- Nmva
- Nmyc and stat interactor
- Nnal-glucuronide
- Nnif
- Nnk
- Nnmt
- No abdominal bruits
- No analgesic
- No anterior movement
- No audible alarm
- No audible prompt/feedback
- No bake coconut cashew bars
- No bed partner or room mate
- No cardiac valve regurgitation
- No cardiac valve stenosis
- No cases
- No change in weight
- No cleavage enzyme used
- No complication
- No cytogenetic response
- No decrease in food intake
- No device output
- No device problem found
- No diarrhea, rectal discomfort, or constipation
- No difference
- No difficulty
- No disease
- No display/image
- No distension with total obstruction of flow
- No dysplasia
- No ecg waveforms present
- No energy at all
- No erections at all
- No errors
- No evidence of disease
- No evidence of leukemia
- No evidence of metastatic disease
- No exertion at all
- No fail safe mechanism
- No fatigue or lack of energy past 30 days
- No fatigue
- No findings available
- No flow
- No health consequences or impact
- No higher limit of normal
- No intent to compound 506e (drug shortage) drugs
- No inversion
- No involvement
- No labial escape
- No longer clinically benefiting
- No longer marketed
- No lower limit of normal
- No man's land
- No mbo, but issues with constipation
- No measurable disease
- No metastasis
- No more
- No mutation detected
- No necrosis
- No one to help
- No opinion
- No or minimal exposure to secondhand smoke
- No pacing
- No pain and no disturbing body sensations
- No partner past 30 days
- No pathologic evidence of distant metastasis
- No patient involvement
- No pattern
- No pressure
- No problem detected
- No protein cleavage reagent used
- No psychological problems
- No rank
- No rearrangement detected
- No reconstruction
- No response/stable disease
- No response/stable response
- No restrictions
- No sexual activity
- No sexual drive or interest
- No shortness of breath
- No smoke exposure
- No srce
- No steady place to sleep at night
- No superior movement of thyroid cartilage
- No urinary control whatsoever
- No urinary frequency or urgency
- No visible initiation at any location
- No visible posterior motion of tb
- No weight loss
- No, I don't want help
- No, I want the help but can't get it
- No, not limited at all
- No-Brainer
- No-See-Um
- No-tillage
- No
- Noblesse
- Nocardia
- Nocardial infection
- Nocardiosis
- Nocent
- Nociception
- Nociceptive pain
- Nociceptive
- Nocifensor
- Nocturia
- Nocturnal activity
- Nocturnal
- Nodal growth differentiation factor gene
- Nodal growth differentiation factor
- Nodal involvement
- Nodal marginal zone lymphoma by ann arbor stage
- Nodal mass
- Nodal station
- Nodal, mouse, homolog of gene
- Nodal
- Node negative
- Node of bizzozero
- Node stage n1a
- Node stage n1b
- Node stage n1c
- Node stage n2a
- Node stage n2b
- Node stage n2c
- Node stage n3a
- Node stage n3b
- Node stage n3c
- Node
- Nodes
- Nodosa
- Nodosum
- Nodular and massive retinal gliosis
- Nodular basal cell carcinoma of the skin
- Nodular lesion
- Nodular partial response
- Nodular sclerosis hodgkin lymphoma, cellular phase
- Nodular sclerosis hodgkin's lymphoma
- Nodular tumor
- Nodular
- Nodule consistency
- Nodule margin conspicuity
- Nodule shape
- Nodule
- Nodules
- Nodulocystic
- Nodulus
- Noel (no observable effect level)
- Nogai
- Nogc, alpha 1 subunit gene
- Nogc, beta 1 subunit gene
- Noise artifact
- Noise, audible
- Noises
- Noisy image
- Noload loss
- Nomenklatura
- Nomina
- Nominal (inflation) pressure
- Nominal diameter
- Nomogenesis
- Nomotopic
- Non a4 component of amyloid precursor
- Non academic hospital
- Non acute inpatient care
- Non adjuvanted a(h1n1) influenza vaccine
- Non aerosol spray dose form
- Non anemic iron deficiency
- Non biological
- Non brca gene variant
- Non cancer diagnosis
- Non carious
- Non citizen national
- Non clinical nanoparticle application
- Non clinical specialty nurse
- Non clonal
- Non commercial sources
- Non communicable disorder
- Non compartmental analysis
- Non compliance with non study device
- Non compliance with study device
- Non compliance with study drug
- Non compliance with study schedule
- Non compliant adam dataset
- Non congenital amegakaryocytosis
- Non convulsive status epilepticus
- Non covid 19 related co morbidity
- Non cr/non pd non cr/non pd
- Non ctc
- Non diagnostic q waves
- Non diagnostic quality
- Non disclosure agreement
- Non encapsulated neoplasm
- Non enzyme inducing aed
- Non esterified fatty acid, free
- Non esterified fatty acid, saturated
- Non esterified fatty acid, unsaturated
- Non fasting biospecimen
- Non focal metastasis
- Non fucosylated umbilical cord blood tregs
- Non functional brca mutation
- Non functional defect
- Non gc/abc dlbcl
- Non health care professional
- Non hematopoietic stem cell research
- Non hemolyzed
- Non hereditary lesion
- Non hereditary
- Non hodgkin lymphoma by ann arbor stage
- Non hodgkin lymphoma during pregnancy
- Non hodgkin lymphoma in remission
- Non hodgkin lymphoma
- Non hodgkin lymphomas
- Non hodgkin's lymphoma of the nasal cavity
- Non hodgkin
- Non homologous end joining
- Non household environment
- Non human clinical subject data section
- Non human gene
- Non human papillomavirus related pein
- Non human protein
- Non human source plasma
- Non idmc cmte doc
- Non igm mgus
- Non inbred obese stock atp7a^mo to (tortoise) mutn
- Non index lesion
- Non infective inflammatory bowel disease
- Non insulin hypoglycemic
- Non intestinal type
- Non invasive cardiac stress test
- Non invasive cribriform carcinoma
- Non invasive cribriform ductal breast carcinoma
- Non invasive detection
- Non invasive lesion
- Non invasive papillary transitional cell carcinoma
- Non investigational product documentation
- Non investigational product supply plan
- Non ischemic stroke
- Non keratinizing malignant squamous cell
- Non linear parameter identification
- Non malignant neoplasm
- Non malignant nodule
- Non mammalian organisms as models for cancer
- Non measurable
- Non medical object or device
- Non melanoma related
- Non melanomatous lesion
- Non metastatic brain neoplasm
- Non metastatic breast carcinoma
- Non metastatic cerebral neoplasm
- Non metastatic childhood rhabdomyosarcoma
- Non metastatic esophageal carcinoma
- Non metastatic extraskeletal ewing's sarcoma
- Non metastatic extraskeletal osteogenic sarcoma
- Non metastatic head and neck carcinoma
- Non metastatic lung carcinoma
- Non metastatic malignant brain neoplasm
- Non metastatic malignant hemangiopericytoma
- Non metastatic neoplasm
- Non metastatic prostate carcinoma
- Non mucoid
- Non muscle invasive bladder urothelial carcinoma
- Non necrotizing
- Non neoplastic appendix disorder
- Non neoplastic bone disorder
- Non neoplastic chest wall disorder
- Non neoplastic conjunctival disorder
- Non neoplastic connective tissue
- Non neoplastic corneal disorder
- Non neoplastic disorder, nos
- Non neoplastic disorder
- Non neoplastic endocrine pancreas disorder
- Non neoplastic eye disease
- Non neoplastic eyelid disorder
- Non neoplastic genitourinary system disorder
- Non neoplastic gingival disorder
- Non neoplastic lacrimal apparatus disorder
- Non neoplastic lip disorder
- Non neoplastic middle ear disorder
- Non neoplastic muscle disorder
- Non neoplastic musculoskeletal system disorder
- Non neoplastic optic nerve disorder
- Non neoplastic oral disease
- Non neoplastic retinal disorder
- Non neoplastic skin cyst
- Non neoplastic soft tissue disorder
- Non neoplastic sternal disorder
- Non neoplastic stomach disorder
- Non neoplastic tongue disorder
- Non neoplastic tonsillar disorder
- Non neoplastic trigeminal nerve disorder
- Non neoplastic ureter disorder
- Non neoplastic urethra disease
- Non neoplastic uveal disorder
- Non neoplastic vascular disorder
- Non neoplastic, non molar trophoblastic disorder
- Non nucleic acid
- Non pou domain containing, octamer binding gene
- Non prostatic acid phosphatase
- Non protein coding rna 21 gene
- Non protein coding rna 8
- Non protocol therapy table
- Non protocol
- Non q wave myocardial infarction by ekg finding
- Non radiological progression
- Non rebreather facemask
- Non recurrent esophageal carcinoma
- Non recurrent lung carcinoma
- Non reproducible results
- Non research project
- Non response
- Non rhabdomyosarcoma soft tissue sarcoma
- Non rodent model
- Non severe aplastic anemia
- Non small
- Non smoked tobacco only
- Non solid ground glass pulmonary nodule
- Non specific ekg/ecg changes
- Non specific st t changes
- Non squam epi cells
- Non squamous non small cell lung carcinoma
- Non statin dyslipidemics
- Non steroidal estrogen
- Non stop decay
- Non study equipment malfunction
- Non susceptible
- Non sustained atrial tachycardia by ekg finding
- Non sustained vt
- Non synonymous c kit gene mutation
- Non synonymous janus kinase family gene mutation
- Non t non b acute lymphoblastic leukemia
- Non target enhancing response
- Non target extra nodal
- Non target nodal
- Non target non enhancing response
- Non traumatic extradural hemorrhage
- Non traumatic hemoperitoneum
- Non trunk
- Non tumor cell derivative vaccine
- Non tumor tissue area
- Non uniform signal intensity artifact
- Non union bone fracture
- Non us citizen
- Non v600 braf mutation
- Non vascularized autograft
- Non vegfr tk inhibitor
- Non viral vector gene complex
- Non visceral
- Non voltage dependent calcium channel
- Non word repetition
- Non-acute inpatient care
- Non-anemic iron deficiency
- Non-articulated
- Non-bacterial osteomyelitis
- Non-biologic dmard
- Non-brca gene variant
- Non-cellular tissue component
- Non-cesarean uterine surgical scar
- Non-classic clah (fgd variant)
- Non-clonal
- Non-compartmental analysis
- Non-compliance with non-study device
- Non-compliance with study device
- Non-compliance with study schedule
- Non-compliant adam dataset
- Non-confirmatory result
- Non-contact specular microscopy
- Non-covid-19 related co-morbidity
- Non-cytotoxic drug therapy
- Non-diagnostic q waves
- Non-diarrhea-associated hemolytic uremic syndrome
- Non-disclosure agreement
- Non-discrimination
- Non-enzyme inducing aed
- Non-erosive arthritis
- Non-erythroid ankyrin
- Non-focal metastasis
- Non-fucosylated umbilical cord blood tregs
- Non-functional brca mutation
- Non-hair bearing lip
- Non-hdl cholesterol/hdl cholesterol
- Non-health care professional
- Non-hemolyzed
- Non-high density lipoprotein
- Non-homologous end joining (NHEJ) noncoding strand
- Non-household environment
- Non-human papillomavirus-related pein
- Non-icr/non-iupd
- Non-idmc cmte doc
- Non-igm mgus
- Non-interpretable
- Non-invasive detection
- Non-invasive diagnostic evidence of heart failure
- Non-invasive imaging change
- Non-investigational product documentation
- Non-investigational product supply plan
- Non-keratinizing squamous cell carcinoma
- Non-measurable
- Non-mll mllt10 rearrangement positive
- Non-moribund sacrifice
- Non-msi-h/dmmr
- Non-muscle filamin
- Non-native antigen receptor
- Non-neoplastic disorder, miscellaneous
- Non-neoplastic disorder
- Non-neoplastic findings
- Non-neoplastic lacrimal apparatus disorder
- Non-neoplastic musculoskeletal system disorder
- Non-organic ftt
- Non-pathological
- Non-pd
- Non-probability sample
- Non-prostatic acid phosphatase
- Non-protein coding rna 12 gene
- Non-protocol therapy table
- Non-quantifiable mrd positivity
- Non-rebreather facemask
- Non-regional lymph nodes/ distant lymph nodes
- Non-rhabdomyosarcoma soft tissue sarcoma
- Non-solid ground-glass pulmonary nodule
- Non-squamous epithelial cells
- Non-squamous non-small cell lung carcinoma
- Non-study equipment malfunction
- Non-sustained atrial tachycardia by ekg finding
- Non-syndromic familial thyroid cancer
- Non-synonymous c-kit gene mutation
- Non-synonymous cd246 gene mutation
- Non-synonymous janus kinase family gene mutation
- Non-synonymous sel10 gene mutation
- Non-t non-b acute lymphoblastic leukemia
- Non-target enhancing response
- Non-target enhancing
- Non-target extra nodal
- Non-target nodal
- Non-target non-enhancing response
- Non-target non-enhancing
- Non-v600 activating braf mutation
- Non-v600 braf mutation
- Non-vascular plants
- Non-vegfr tk inhibitor
- Non-wnt/non-shh activated
- NonAlcoholic
- Non
- Nonabsorbent
- Nonacquisitionmodalitiesinstudycode
- Nonaddict
- Nonadherence in children
- Nonadherence
- Nonalcoholic steatohepatitis (nash)
- Nonalcoholic steatohepatitis nash
- Nonalcoholic
- Nonallergic rhinitis
- Nonallergic
- Nonambulatory
- Nonarticular
- Nonassociative
- Nonatheromatous arteriosclerosis
- Nonatheromatous
- Nonatopic
- Noncalcified
- Noncancerous bone tumors
- Noncancerous ovarian growths
- Noncancerous skin growths
- Noncancerous
- Noncarbohydrate
- Noncarcinogenic
- Noncardiac surgical history
- Noncaseating
- Noncatalytic region of tyrosine kinase, beta gene
- Noncholera vibrio infections
- Noncholera
- Nonchronically sun exposed site
- Noncitizen
- Nonclinical study sponsor
- Nonclinical written and tabulated summaries
- Noncommissioned
- Noncommunicable
- Nonconducted p wave physiology not defined
- Nonconforming
- Noncontagious
- Noncontractile
- Nonconvulsive
- Noncoronary
- Noncytotoxic
- Nondiagnostic
- Nondisposable
- Nondisseminated
- Nondrinker
- Nondrowsy
- Nondrying
- None (no use of medication)
- None allergy
- None at all
- None beyond physiologic replacement dose
- None identified
- None of the above
- None or one activity required help
- None to modest pain
- None/recurrence
- None
- Noneffervescent
- Nonenumerated
- Nonerosive gastritis
- Nonerosive
- Nonesuch
- Nonexchangeable site
- Nonfebrile
- Nonflagellated
- Nonfreezing tissue injuries
- Nonfreezing
- Nonfunctional adrenal masses
- Nonfunctional
- Nonfunctioning adrenal cortex adenoma
- Nonfunctioning pituitary gland macroadenoma
- Nonfunctioning pituitary gland microadenoma
- Nongerminomatous germ cell tumor of the cns
- Nonglandular
- Nongonococcal
- Nongranular
- Nongravid
- Nonhealing
- Nonhematic cells/leukocytes
- Nonhematic cells
- Nonhemorrhagic
- Nonheritable
- Nonhistone chromosomal protein hmg2 gene
- Nonhomologous end joining factor 1gene
- Nonhostindicator
- Nonindustrial private forests
- Noninfectious meningitis
- Noninfectious
- Noninfective endocarditis
- Noninfective
- Noninvasive pancreatic mucinous cystic neoplasm
- Nonischemic
- Nonkeratinized
- Nonkeratinizing dysplasia
- Nonketotic
- Nonlymphocytic
- Nonlymphoid
- Nonlysosomal ceramidase c
- Nonmammalian embryo
- Nonmass like enhancement
- Nonmass-like enhancement
- Nonmedullated
- Nonmelanoma
- Nonmembranous cytoplasmic organelle
- Nonmetastatic gestational trophoblastic tumor
- Nonmetastatic
- Nonmuscle myosin heavy chain ii a
- Nonmyeloablative stem cell transplantation
- Nonmyeloid
- Nonnarcotic
- Nonneoplastic
- Nonnervous
- Nonneuronal
- Nonobese
- Nonobstructive
- Nonocclusive
- Nonolfactory
- Nonopaque
- Nonossifying fibromyxoma
- Nonparametric regression method
- Nonparametric test
- Nonpaternity
- Nonphotosensitive
- Nonpolyposis
- Nonprofit corporations
- Nonpulsatile
- Nonreasoncode
- Nonreduction
- Nonrenal cl norm by bmi
- Nonrenal cl norm by dose
- Nonrenal cl norm by sa
- Nonrenal cl norm by wt
- Nonrenal cl
- Nonrenal
- Nonrenewable
- Nonreplicating
- Nonrequirements consumer
- Nonresponse therapy type
- Nonrheumatoid
- Nonrhythmic
- Nonribosomal peptides
- Nonrotatory
- Nonsedating
- Nonsedative
- Nonsense mediated mrna decay
- Nonsmall cell adenocarcinoma
- Nonspecific interstitial pneumonia
- Nonspecific murmur
- Nonspecific symptoms
- Nonspecific
- Nonspore forming
- Nonspore
- Nonstandard device
- Nonsteroidal estrogens
- Nonstress
- Nonstriated
- Nonsugar
- Nonsuicidal self injury nssi
- Nonsuicidal self injury
- Nonsuicidal
- Nonsuppurative
- Nonsustained supraventricular tachycardia
- Nonsyndromic pancreatic endocrine tumor
- Nonsynonymous mutation
- Nontariff trade barriers
- Nontaster
- Nonthrombocytopenic
- Nonthrombotic pulmonary embolism
- Nonthrombotic
- Nontoxic
- Nontraumatic
- Nontuberculous mycobacterial infections
- Nontuberculous
- Nontyphoidal salmonella infections
- Nontyphoidal
- Noonan syndrome
- Noonan's Syndrome
- Noonan
- Nop10 ribonucleoprotein gene
- Nop53 ribosome biogenesis factor gene
- Nopho
- Nora's lesion
- Norelgestromin
- Norepexr
- Norepinephrine receptor
- Norepinephrine secreting
- Norepinephrine secretion induction
- Norethynodrel
- Norfloxacin
- Norgestimate
- Norgestrel
- Norleucine
- Norlignans
- Norm by bmi
- Norm by dose
- Norm by sa
- Norm by wt
- Normal Weight
- Normal amount of sexual drive and interest for you
- Normal appearance of the extremities
- Normal blood test result
- Normal bone marrow test result
- Normal breast like subtype of breast cancer
- Normal capillary refill
- Normal carotid arteriogram
- Normal cells/total cells
- Normal cerebral arteriogram
- Normal coronary arteriogram
- Normal crossreacting antigen positive
- Normal crossreacting antigen
- Normal lab test result
- Normal labor and delivery
- Normal laboratory values
- Normal load
- Normal or reference range description
- Normal pregnancy
- Normal pressure hydrocephalus
- Normal range for character results
- Normal range indicator
- Normal range lower limit for standardized result
- Normal range upper limit for standardized result
- Normal renal arteriogram
- Normal saturation
- Normal situs
- Normal thoracic appearance
- Normal tissue segment
- Normal urine test result
- Normal, average (2-2.9 mph)
- Normal
- Normality
- Normalized time
- Norman Thomas
- Normbaso
- Normdp
- Normeexr
- Normergic
- Normergy
- Normetanephrine secreting
- Normetanephrine
- Normoactive
- Normoblast
- Normoblastic erythroid hyperplasia
- Normoblasts/total cells
- Normocalcemia
- Normochromia
- Normochromic
- Normocyte
- Normocytic
- Normoglycemia
- Normokalemic
- Normokpp
- Normotension
- Normotonic
- Normovolemia
- Norovirus genogroup I and/or genogroup ii rna
- Norovirus genogroup ii.4 iga antibody
- Norovirus genogroup ii.4 igg antibody
- Norovirus genogroup ii.4 igm antibody
- Norplant
- Norrie
- Norseman
- Norspermine
- Nortestrionate
- North Platte
- North african
- North caspian language
- North central states
- North korean
- North mbundu
- North mid atlantic states
- North ndebele
- North star
- North-central
- North
- Northampton
- Northbound
- Northeast Region
- Northeastern asian descent
- Northern europe
- Northern frisian
- Northern midwest states
- Northern
- Nortriptyline/en
- Norvaline
- Norwalk calicivirus
- Norwalk-like virus
- Norway maple
- Norwegian bokmal
- Norwood
- Nose and paranasal sinus disorders
- Nose and sinus disorders
- Nose and sinuses
- Nose disorders
- Nose swab
- Nose
- Nosebleeds
- Nosed
- Nosema
- Nosher
- Nosogeography
- Nosography
- Nosologist
- Nosophobia
- Nosopsyllus
- Not a combination product
- Not above shoulder
- Not above waist
- Not acting self
- Not alert
- Not allowed to collect
- Not applicable - never quit
- Not applicable - not currently working
- Not as good
- Not asked
- Not assigned
- Not associated with abnormality
- Not associated with disease
- Not at all bothered
- Not at all comfortable
- Not at all good
- Not at all helpful
- Not at all important
- Not at all satisfied
- Not at all short of breath
- Not at all sure
- Not at all tired
- Not being able to stop or control worrying
- Not bothered at all
- Not cancer related
- Not classified
- Not compounding from bulk ingredient
- Not compounding sterile products
- Not controlled by medication
- Not defined
- Not determined
- Not difficult at all
- Not disrupted at all
- Not done, left
- Not done, right
- Not during the past month
- Not eligible
- Not enough to make ends meet
- Not erupted tooth
- Not evaluated: not provided or available
- Not evaluated
- Not firm enough for any sexual activity
- Not for profit organization
- Not fused
- Not identified
- Not independent
- Not known if testing was performed
- Not known
- Not less than
- Not limited at all
- Not made with natural rubber latex
- Not measured
- Not meeting criteria
- Not more than
- Not obtained
- Not often
- Not otherwise specified genetic subtypes
- Not provided or available
- Not quite so much now
- Not responsive
- Not returned
- Not solved
- Not true at all
- Not very much
- Not very sure
- Not-evaluated: not provided or available
- Not-for-profit
- Not
- Notary
- Notatum ige ab rast score
- Notatum igg ab rast score
- Notch 1 gene
- Notch 2 gene
- Notch 3 gene
- Notch 3 staining method
- Notch 4 gene
- Notch homolog 3 gene mutation
- Notch homolog 4 gene mutation
- Notch intracellular domain
- Notch like egf repeat containing gene
- Notch receptor gene family mutation
- Notch receptors
- Notch, drosophila, homolog of, 3 gene
- Notch1 activating mutation
- Notch2 activating mutation
- Notch3 activating mutation
- Notch4 activating mutation
- Notched (concavity)
- Note to file master list
- Note
- Nothing made me happy
- Nothings
- Nothosaur
- Notice throat discomfort;throat discomfort
- Notification of discontinuation of clinical trial
- Notification of regulatory identification number
- Notificationreceiver
- Notified body (nb)
- Notoedres
- Notoedric
- Notonectidae
- Nottingham grade
- Nov gene
- Nova Scotia salmon
- Nova family gene
- Nova family
- Novantrone/fluorouracil/leucovorin
- Novantrone/oncovin/vinblastine/prednisone
- Novasure endometrial ablation
- Novasure
- Novel apoptosis related
- Novel foods
- Novel interleukin receptor
- Novel neurotrophin 1
- Novel reductase 1
- Novelisation
- Novembichin
- Novial
- Novidium chloride
- Novottf 100l system
- Novottf-100l system
- Novottf-200a system
- Nowise
- Nowruz
- Noxa
- Nozin
- Np 000032.1:p.Cys130arg,arg176arg
- Np 000050.2:p.Ser1982argfs
- Np 000101.2:p.Ile543val
- Np 000121.2:p.Arg534gln
- Np 000132.3:p.Pro253arg
- Np 000132.3:p.Ser252trp
- Np 000242.1:p.Ala636pro
- Np 000507.1:p.Q125r
- Np 000507.1:p.Q227e
- Np 000507.1:p.Q227l
- Np 000507.1:p.Q227p
- Np 000507.1:p.Q227r
- Np 000507.1:p.R160c
- Np 000507.1:p.R201c
- Np 000507.1:p.R201h
- Np 000507.1:p.R201s
- Np 000509.1:p.Glu122lys
- Np 000509.1:p.Glu7lys
- Np 000509.1:p.Glu7val
- Np 001020329.1:p.Pro98ser
- Np 001091679.1:p.Thr41ala
- Np 001138385.1:p.Cys383arg
- Np 001138385.1:p.Lys660glu
- Np 001138385.1:p.N550h
- Np 001138385.1:p.N550k
- Np 001138385.1:p.Ser373cys
- Np 001138385.1:p.Y376c
- Np 001138388.1:p.Val564phe
- Np 001280119.1:p.Q338h
- Np 001895.1:p.Ser37phe
- Np 001895.1:p.Ser45phe
- Np 001895.1:p.Ser45pro
- Np 002098.1 :p.Lys28met
- Np 002159.2:p.R140g
- Np 002159.2:p.R140l
- Np 002159.2:p.R140q
- Np 002159.2:p.R140w
- Np 002159.2:p.R140x
- Np 002159.2:p.R172s
- Np 002159.2:p.R172w
- Np 002159.2:p.R172x
- Np 002459.2:p.Leu265pro
- Np 003528.1:p.Lys28met
- Np 004039.1:p.Met1arg
- Np 004295.2:p.Gly1128ala
- Np 004295.2:p.Gly159fs
- Np 004295.2:p.Ile1170asn
- Np 004295.2:p.Ile1170ser
- Np 004295.2:p.Ile1171asn
- Np 004295.2:p.Leu1196met
- Np 004295.2:p.Lys1062met
- Np 004295.2:p.Met1166arg
- Np 004295.2:p.Phe1174cys
- Np 004295.2:p.Phe1174leu
- Np 004295.2:p.Phe1174val
- Np 004295.2:p.Phe1174xxx
- Np 004295.2:p.Phe1245ile
- Np 004295.2:p.Phe1245leu
- Np 004295.2:p.Phe1245xxx
- Np 004295.2:p.R1192p
- Np 004295.2:p.R1275q
- Np 004295.2:p.R1275x
- Np 004295.2:p.Thr1087ile
- Np 004295.2:p.Y1278s
- Np 004955.2:p.Y303h
- Np 005887.2:p.R119q
- Np 005887.2:p.R132c
- Np 005887.2:p.R132g
- Np 005887.2:p.R132h negative
- Np 005887.2:p.R132h
- Np 005887.2:p.R132l
- Np 005887.2:p.R132s
- Np 005887.2:p.R132v
- Np 005887.2:p.R132x
- Np 006051.1:p.N159y
- Np 009225.1:p.Glu23valfs
- Np 009225.1:p.Q1756pfs
- Np 072046.2:p.Pro904leu
- Np 109587.1:p.Pro128leu
- Np 758519.1:p.Gly751ala
- Np 803187.1:p.Glu1813asp
- Np 803187.1:p.Y1225x
- Npb no palliative benefit
- Npb-no palliative benefit
- Npbaf complex
- Npc 1c
- Npc1 like 1 gene
- Npcr
- Npd
- Npepps
- Npi questionnaire question
- Npi1a
- Npi1afs
- Npi1b
- Npi1bfs
- Npi1c
- Npi1cfs
- Npi1d
- Npi1dfs
- Npi1dist
- Npi1e
- Npi1efs
- Npi1f
- Npi1ffs
- Npi1g
- Npi1gfs
- Npi1h
- Npi1hfs
- Npi1i
- Npi1ifs
- Npi1j
- Npi1jfs
- Npi1k
- Npi1kfs
- Npi1l
- Npi1lfs
- Npi1tot
- Npkc delta
- Npkc epsilon
- Npkc iota
- Npkc mu
- Npkc nu
- Npkc-delta
- Npkc-epsilon
- Npkc-iota
- Npm1 alk fusion gene
- Npm1-rara long fusion gene
- Npm1-rara short fusion gene
- Npmc+ aml
- Npmc
- Npmw-peptide vaccine
- Npo
- Nppb gene product
- Nprap
- Nprpsa antibody
- Nps questionnaire question
- Nps0108a
- Nps0108b
- Nps0108c
- Nps0108d
- Nps0110a
- Nps0110b
- Npt timing
- Npt type
- Npy1-r
- Nqo
- Nr lu 10 antigen
- Nr-no response
- Nr2a
- Nr3a1 gene mutation
- Nr3a1 status by immunohistochemistry
- Nr3a2 status by immunohistochemistry
- Nr3c4 staining method
- Nr4a3/ewsr1 fusion gene
- Nrage
- Nrarp
- Nras mutational analysis performed
- Nras mutational analysis testing method
- Nrdr
- Nrpntacc
- Nrsa individual postdoctoral fellowships (f32)
- Nrsa
- Nsaa clinical classification question
- Nsaa111a
- Nsaa117a
- Nsar
- Nsc number property
- Nsclc with egfr thr790met mutation
- Nsclc-specific mils
- Nsd1 nup98 fusion gene
- Nsd1 nup98 fusion protein
- Nse positive neoplastic cells present
- Nsf attachment protein alpha gene
- Nsmaf
- Nsmase
- Nssi
- Nt5e
- Nta agarose
- Ntai
- Ntau-methylhistidine
- Ntds
- Ntelocrt
- Ntelop
- Nth like dna glycosylase 1 gene
- Ntind
- Ntlwind
- Ntms
- Ntrk1 tpm3 fusion gene
- Ntrk3/etv6 fusion gene
- Nu/cl
- Nu/nu
- Nuance
- Nuc agent ionizing radiation type
- Nuc agent irradiation source beam strength
- Nuc agent mixed field indicator
- Nuc agent radioisotope species name
- Nuc agent source
- Nuc challenge agent
- Nuc targeted injury
- Nuchal cord
- Nuchal lymph node
- Nuchal
- Nucle/us (in cell biology)
- Nuclear assembly factor 1 ribonucleoprotein gene
- Nuclear body protein gene
- Nuclear division alteration
- Nuclear enlargement
- Nuclear expression intact
- Nuclear extract
- Nuclear factor (erythroid derived 2) like 2 gene
- Nuclear factor (erythroid derived 2), 45kda gene
- Nuclear factor I/a gene
- Nuclear factor I/a wt allele
- Nuclear factor I/b gene
- Nuclear factor I/b wt allele
- Nuclear factor from high endothelial venules
- Nuclear factor kappa b subunit 2 gene
- Nuclear factor nfkappab inhibitor kinase
- Nuclear factor of activated t-cells 45 kda
- Nuclear factor of activated t-cells
- Nuclear factor, erythroid 2 like 2 gene mutation
- Nuclear factor, interleukin 3 regulated gene
- Nuclear factor, interleukin 3 regulated wt allele
- Nuclear gastrointestinal scans
- Nuclear gene
- Nuclear grade iii or iv
- Nuclear hormone receptors
- Nuclear inclusions
- Nuclear localization signals
- Nuclear matrix protein-22 assay
- Nuclear matrix protein
- Nuclear medicine subcategory
- Nuclear mitogen
- Nuclear mitotic apparatus protein 1 gene
- Nuclear mitotic apparatus protein 1 wt allele
- Nuclear pleomorphism present
- Nuclear protein in testis fusion gene positive
- Nuclear protein in testis gene rearrangement
- Nuclear protein in testis gene translocation
- Nuclear protein in testis gene
- Nuclear protein in testis midline carcinoma
- Nuclear protein in testis positive
- Nuclear receptor binding factor 1 gene
- Nuclear receptor binding protein 1 gene
- Nuclear receptor binding protein 1 wt allele
- Nuclear receptor binding protein
- Nuclear receptor binding set domain protein 1 gene
- Nuclear receptor co repressor 1 gene
- Nuclear receptor co repressor 2 gene
- Nuclear receptor coactivator 1 gene
- Nuclear receptor coactivator 2 gene
- Nuclear receptor coactivator 3 gene
- Nuclear receptor coactivator 4 gene
- Nuclear receptor coactivator 5 gene
- Nuclear receptor coactivator 5 wt allele
- Nuclear receptor coactivator 6 gene
- Nuclear receptor coactivator gene
- Nuclear receptor gene
- Nuclear receptor interacting protein 1 gene
- Nuclear receptor interacting protein 3 gene
- Nuclear receptor interacting protein 3 wt allele
- Nuclear receptor subfamily 1 group I member 2 gene
- Nuclear receptor subfamily 1 group a
- Nuclear receptor subfamily 1 group h member 3 gene
- Nuclear receptor subfamily 1 group h
- Nuclear receptor subfamily 3 group a
- Nuclear scan
- Nuclear scans of the digestive tract
- Nuclear staining
- Nuclear swelling
- Nuclear transcription factor nf kb
- Nuclear transcription factor nf-kb
- Nuclear transcription factor y, alpha gene
- Nuclear transcription factor y, alpha wt allele
- Nuclear translocation
- Nuclear
- Nuclease protection assay
- Nucleated blood cell
- Nucleated red blood cells present
- Nucleated red cells
- Nucleation
- Nuclei of various sizes and shapes present
- Nuclei, structure/function
- Nucleic Acid
- Nucleic acid aliquot unique identifier
- Nucleic acid binding
- Nucleic acid biochemistry, dna
- Nucleic acid biochemistry, enzymology
- Nucleic acid biochemistry, rna - ribonucleic acid
- Nucleic acid biochemistry, rna
- Nucleic acid biochemistry, synthesis
- Nucleic acid biochemistry
- Nucleic acid bond constituents
- Nucleic acid bond
- Nucleic acid cleavage
- Nucleic acid concentration
- Nucleic acid core facility
- Nucleic acid detection reagent
- Nucleic acid extraction reagent
- Nucleic acid folding
- Nucleic acid for in vitro diagnostic device
- Nucleic acid synthesis alteration
- Nucleic acid synthesis
- Nucleic acid testing
- Nucleic acid type
- Nucleic acid volume
- Nucleic acid
- Nucleic rna
- Nucleic
- Nucleicacidphysicallocation
- Nucleicacidsequencefeature
- Nucleocapsid protein
- Nucleocytoplasmic interaction
- Nucleocytoplasmic shuttling
- Nucleocytoplasmic transport
- Nucleocytoplasmic
- Nucleohistone
- Nucleolar and spindle associated protein 1 gene
- Nucleolar associated chromatin
- Nucleolar protein ankt
- Nucleolar protein family a, member 2 gene mutation
- Nucleolar protein family a, member 2 gene
- Nucleolar protein family a, member 3 gene mutation
- Nucleolar protein family a, member 3 gene
- Nucleolar
- Nucleolin gene
- Nucleolin wt allele
- Nucleolonema
- Nucleophosmin gene mutation
- Nucleoporin 107kda gene
- Nucleoporin 107kda wt allele
- Nucleoporin 214kda gene
- Nucleoporin 93 gene
- Nucleoporin 98 gene mutation
- Nucleoporin 98 gene rearrangement
- Nucleoporin 98 gene
- Nucleoporin gene
- Nucleoporin, 93-kd gene
- Nucleoporin, 98 kd gene
- Nucleoporins
- Nucleoprotamine
- Nucleosidase
- Nucleoside diphosphate kinase a gene
- Nucleoside-triphosphate phosphatase
- Nucleosomal linker
- Nucleosomal repeat length
- Nucleosome occupancy and methylome sequencing
- Nucleosome remodeling factor, large subunit
- Nucleosome remodeling factor
- Nucleotidase deficiency
- Nucleotidase protein variant
- Nucleotide / nucleic acid chemistry
- Nucleotide analog chemotherapy
- Nucleotide aptamers
- Nucleotide connection points
- Nucleotide excision repair inhibition
- Nucleotide metabolism alteration
- Nucleotide motifs
- Nucleotide substitution site
- Nucleotide synthesis alteration
- Nucleotide
- Nucleotidyltransferase
- Nucleotoxic
- Nucletron oncentra
- Nucleus lenticularis
- Nucleus of diagonal band
- Nucleus
- Nude mouse assay
- Nude
- Nuel
- Nuf2, ndc80 kinetochore complex component gene
- Nuf2r
- Null mouse
- Null
- Nulligravida
- Nullipara
- Nulliparity
- Nullisomic
- Nullisomics
- Nullizygous
- Num fraction
- Num metaphases
- Num nuc markers exhibit instability
- Numatrin
- Numb homolog (drosophila) gene
- Number cancellation: correct
- Number cancellation: errors
- Number cancellation: remind
- Number cancellation
- Number full term live births
- Number hla
- Number matches
- Number of brothers, biological
- Number of children in household
- Number of days since last cigarette
- Number of days stayed off cigarettes
- Number of drugs used at visit
- Number of drugs used since last visit
- Number of eeg electrodes
- Number of ekg electrodes
- Number of emg electrodes
- Number of eog electrodes
- Number of frames
- Number of full term pregnancies
- Number of groups/cohorts
- Number of hospitalization days
- Number of hospitalizations
- Number of independent abberations in karyotype
- Number of intended intrathecal chemotherapy doses
- Number of letters correct
- Number of light bulbs
- Number of lines read
- Number of mines
- Number of months since last cigarette
- Number of months stayed off cigarettes
- Number of other lymph nodes examined
- Number of pack years smoked
- Number of para aortic lymph nodes examined
- Number of pelvic lymph nodes examined
- Number of prior regimens any therapy
- Number of prior regimens nsaid
- Number of prior regimens steroid
- Number of prostate cores positive for carcinoma
- Number of refills
- Number of regional lymph nodes positive
- Number of sisters, biological
- Number of trial sites eu state
- Number of weeks since last cigarette
- Number of weeks stayed off cigarettes
- Number of years since last cigarette
- Number of years stayed off cigarettes
- Number type
- Numbertext
- Numbness in the breast or chest area
- Numbness in the underarm, arm or hand
- Numbness in your arm
- Numbness or tingling question
- Numbness/tingling in hands/feet
- Numbness
- Numchrrd
- Numchrur
- Numeric age for data tabulation
- Numeric conversion
- Numeric echocardiogram test result unit
- Numeric echocardiogram test result
- Numeric lab test result unit
- Numeric lab test result
- Numeric minimal residual disease result unit
- Numeric minimal residual disease result
- Numeric rating scale 11-point
- Numeric rating scale 21 point
- Numeric rating scale 21-point
- Numeric rating scale 5 point
- Numeric rating scale 5-point
- Numeric rating scale 6-point
- Numeric result or finding in standard format
- Numeric value
- Numerical pain scale
- Numerical
- Numi
- Numlinur
- Nummular dermatitis
- Nummular
- Numrpt
- Numslice
- Nunnation
- Nup protein
- Nup214/dek fusion gene
- Nup98 add3 fusion gene
- Nup98 ddx10 fusion gene
- Nup98 hoxa9 fusion gene
- Nup98 hoxc13 fusion gene
- Nup98 hoxd11 fusion gene
- Nup98 hoxd13 fusion gene
- Nup98 nsd1 fusion gene
- Nup98-nup96 precursor
- Nup98/pmx1 fusion gene
- Nup98/rbbp2 fusion gene
- Nurf301, drosophila, homolog of gene
- Nurse and I work together to make decisions
- Nurse informaticist
- Nurse midwifery
- Nurse
- Nurses' health study
- Nursing health policy specialist
- Nursing home nursing
- Nursing home stay
- Nursing homes
- Nursing information system
- Nursing of the elderly
- Nursing profession
- Nursing sciences, clinical
- Nursing staff development specialist
- Nursing
- Nut banding stomach
- Nut bread
- Nut bypassing part digestive tract
- Nut gastric banding
- Nut gastric bypass surgery
- Nut mini nutritional assessment
- Nut mix antigen ige antibody
- Nut mix antigen igg antibody
- Nut mix ige ab rast score
- Nut mix igg ab rast score
- Nut simplified nutritional assessment
- Nut translocation
- Nut/brd4 fusion gene
- Nutm2a
- Nutm2b
- Nutmeg geranium
- Nutmeg
- Nutrient availability
- Nutrient drug interactions
- Nutrient offtake
- Nutrient resorption (physiology)
- Nutrient-rich bread mix iatta
- Nutrient
- Nutrients of public health concern
- Nutrifriend cachexia
- Nutrilite
- Nutrition Evidence Library (NEL) Systematic Review
- Nutrition Evidence Systematic Review
- Nutrition after surgery eras
- Nutrition and exercise during pregnancy
- Nutrition assessment
- Nutrition before surgery eras
- Nutrition during cancer treatment
- Nutrition for seniors
- Nutrition general considerations
- Nutrition in clinical medicine
- Nutrition in infants
- Nutrition monitoring
- Nutrition physiology
- Nutrition research
- Nutrition risk assessment
- Nutrition shared resource
- Nutrition surveys
- Nutrition, selenium
- Nutrition-genotype interaction
- Nutrition
- Nutritional anthropometry
- Nutritional calciopenic rickets
- Nutritional carcinogenesis
- Nutritional disorders
- Nutritional intervention
- Nutritional requirements
- Nutritional support
- Nutritional
- Nutriture
- Nuts and bolts
- Nuttalia
- Nuytsia
- Nv1020
- Nvac
- Nveltm
- Nvgrpid
- Nvisionvle imaging system
- Nvlnkgrp
- Nvlnkid
- Nvp-auy922-agb
- Nvp-bez235-nx
- Nvrefid
- Nvspid
- Nvstat
- Nvtptref
- Nwts
- Nwtsg stage I y
- Nwtsg stage ii y
- Nwtsg stage iii y
- Nwtsg staging system
- Ny eso 1/lage 1 hla class I/ii peptide vaccine
- Ny eso b
- Ny-eso-1 antibody
- Ny-eso-1 c259 t cells
- Ny-eso-1 positive tumor cells
- Ny-eso-1 tcr-transduced autologous pbmcs
- Ny-eso-1 tcr/sr39tk-modified autologous pbsc
- Ny-eso-1/mart-1 peptide-pulsed dc vaccine
- Ny-eso-1/mart-1/klh/montanide isa-51 vg vaccine
- Ny-eso-1b positive
- Ny-eso-2 antibody
- Ny-eso-2 positive
- Ny-esoc259t
- Nyanja
- Nyctalope
- Nyha class iv
- Nyha iii/iv
- Nyhan
- Nylidrin
- Nymphaea caerulea
- Nynrin
- Nyoro
- Nystagmic
- Nystagmograph
- Nystagmography
- Nystagmoid
- Nystagmus
- Nystatin/en
- Nzima
- Nzl
See also[edit source]
- Encyclopedia of Medicine
- List of Medical terms
- Cancer terms
- Drugs
- Cancer drugs
- Health topics
- Rare diseases
- List of lists
Medicine:Encyclopedia | Dictionary | Glossary | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | P1 | Q | R | R1 | S | S1 | T | T1 | U | V | W | X | Y | Z | 0-9 |
Popular Glossaries | Dictionaries | Lists & Glossaries | Topics |
---|---|---|---|
Navigation: Wellness - Encyclopedia - Health topics - Disease Index - Drugs - World Directory - Gray's Anatomy - Keto diet - Recipes
Search WikiMD
Ad.Tired of being Overweight? Try W8MD's physician weight loss program.
Semaglutide (Ozempic / Wegovy and Tirzepatide (Mounjaro) available.
Advertise on WikiMD
WikiMD is not a substitute for professional medical advice. See full disclaimer.
Credits:Most images are courtesy of Wikimedia commons, and templates Wikipedia, licensed under CC BY SA or similar.
Contributors: Prab R. Tumpati, MD