Encyclopedia-of-medicine-N
- N acylaminoacyl peptide hydrolase gene
- N all trans (4 methoxyphenyl)retinamide
- N butyl n (4 hydroxybutyl) nitrosamine
- N butylbiguanide hcl
- N de ocampo
- N dihydro galacto chitosan
- N dimethylarginine
- N formylmethionine aminopeptidase
- N formylpeptide receptor
- N glycosylation site
- N hexadecyl alcohol
- N igg antibody
- N methyl n nitroso ethylcarbamate
- N methylpurine dna glycosylase gene
- N methylpurine dna glycosylase
- N mrna
- N myc (and stat) interactor wt allele
- N myristoylation
- N myristoyltransferase 2 wt allele
- N nitroso n phenylhydroxylamine ammonium salt
- N nitroso urea
- N oxide
- N ras negative
- N terminal amino acid
- N trideuteromethyl enzalutamide
- N' hexamethylenebisacetamide
- N' methylurea
- N(epsilon)-(carboxyethyl)lysine
- N,n bianiline
- N,n dibenzyldaunorubicin
- N,n dimethylcarbamoyl chloride
- N,n ethylenethiourea
- N,n'-hexamethylenebisacetamide
- N,n-dibenzyldaunorubicin
- N,n-dimethylarginine
- N-formylmethionine aminopeptidase
- N-hexadecylphosphorylcholine
- N-methyl-11c-methylaminoisobutyric acid
- N-of-1 study
- N-substituted glycines
- N-trideuteromethyl enzalutamide
- N-wasp
- N/a-remission
- N0 (I )
- N0 (I+)
- N0 (mol )
- N0 (mol+)
- N1 dlbcl
- N1,n11-bis(ethyl)norspermine
- N1bi
- N1bii
- N1biii
- N1biv
- N1mi
- N1n14 diethylhomospermine
- N1slptst
- N2 latency
- N2slptst
- N3slptst
- N5 (aminocarbonyl) l ornithine
- N6l
- N75lat
- NAACLS
- NAPCRG
- NAvigation
- NCA
- NCTMB
- NGU
- NKC
- NKF
- NOTE
- NOX
- NPC
- NPSA
- NRAEMT
- NREMR
- NREMT
- NT
- NURE
- NYHA
- Na 17/mage 3.A2/ny eso 1 peptide vaccine
- Na+/k+ transporting atpase interacting 2 gene
- Na17 a
- Na17 peptide (amino acid sequence vlpdvfircv)
- Na17.A2
- Naaccr terminology
- Naanaag
- Nab paclitaxel carboplatin pembrolizumab regimen
- Nab paclitaxel cisplatin pembrolizumab regimen
- Nab pc regimen
- Nab thiocolchicine dimer
- Nab-paclitaxel-carboplatin-pembrolizumab regimen
- Nab-paclitaxel-cisplatin-pembrolizumab regimen
- Nab-pc regimen
- Nab-thiocolchicine dimer
- Nabalus
- Nablus
- Nabothian
- Nabtc
- Nabtt
- Nabumetone/en
- Nacho chicken casserole
- Nacho steak skillet
- Nacho
- Nacreous cloud
- Nad specific malate dehydrogenase
- Nad+
- Nad-binding fold
- Nad-specific malate dehydrogenase
- Nadh coq reductase (complex I) deficiency
- Nadh dependent methemoglobin reductase deficiency
- Nadh-dependent methemoglobin reductase deficiency
- Nadolol
- Nadp inhibitors
- Naegleria
- Naepaine
- Nafcillin
- Naferon
- Nafld fibrosis score
- Nafoxidine
- Nagano
- Nagasexr
- Nagat
- Nagging feeling in your breast area
- Nagsd
- Naics
- Nail biting
- Nail deformities and dystrophies
- Nail diseases and problems
- Nail disorders
- Nail loss
- Nail patella syndrome
- Nail ridging
- Nail
- Nailbrush
- Nailing
- Nails
- Nairobi
- Naja
- Najjar
- Nakuruitis
- Nalline
- Naloxone hydrochloride dehydrate lotio
- Nalp4 antibody
- Naltrexone hydrochloride bupropion hydrochloride
- Naltrexone hydrochloride-bupropion hydrochloride
- Name and version
- Name of epidemic and/or pandemic
- Name/value pair
- Name
- Nameko
- Namespace entity
- Naming objects and fingers: middle
- Naming objects and fingers: pinky
- Naming objects and fingers: pointer
- Naming objects and fingers: ring
- Naming objects and fingers: thumb
- Naming objects and fingers
- Naming
- Namur
- Nana
- Nanaimo
- Nangibotide
- Nanism
- Nannizzia otae
- Nano device
- Nanoarray
- Nanocatalysts
- Nanocephalic
- Nanochannel
- Nanocis
- Nanoclays
- Nanocontainer
- Nanocrystals
- Nanocurie(s)
- Nanocurie
- Nanoemulsions
- Nanofabricate
- Nanofiber
- Nanoimprint
- Nanoliposomal ceramide
- Nanoliter
- Nanolithography
- Nanomaterial
- Nanometals
- Nanomole
- Nanoparticle based luteolin
- Nanoparticle chemical composition
- Nanoparticle complex
- Nanoparticle epirubicin
- Nanoparticle functionality
- Nanoparticle physical characterization
- Nanoparticle surface characteristic
- Nanoparticle targeted drug
- Nanoparticle topology
- Nanoparticle-based luteolin
- Nanoplastics
- Nanoplatin
- Nanorod
- Nanorods
- Nanos homolog 3 (drosophila) gene
- Nanos homolog 3 (drosophila) wt allele
- Nanoscale mechanism
- Nanoscale process
- Nanoshell
- Nanosphere
- Nanotax
- Nanotherm therapy system
- Nanoxelm
- Nanticoke
- Nantua
- Nap imaging agent
- Nap22, rat, homolog of gene
- Napbc
- Napery
- Naphazoline
- Naphthalenesulfonic
- Naphtho(1,2,3,4,def)chrysene
- Naphtholsulfonic
- Naphthoquinone
- Naphthyl
- Napolitaine
- Naprapath
- Naproxen/en
- Napsylate
- Naranjo scale
- Naratriptan
- Narceine
- Narcissistic personality disorder npd
- Narcissistic personality disorder
- Narcissistic
- Narcoanalysis
- Narcoanesthesia
- Narcodiagnosis
- Narcohypnosis
- Narcolepsy
- Narcomania
- Narcose
- Narcosuggestion
- Narcotan
- Narcotherapy
- Narcoticism
- Narcotine
- Narcotism
- Narcotization
- Narcotoline
- Narrative appeal
- Narrow bantu language
- Narrow column of contrast or air between tb and pw
- Narrow spectrum
- Narrow therapeutic indices
- Narrow
- Narrowed filtration angle
- Narrowing of the bile ducts due to aids
- Narrowing
- Narthex
- Nas/iom
- Nasal applicator
- Nasal cancer
- Nasal cavity and paranasal sinus adenocarcinoma
- Nasal cavity and paranasal sinus nut carcinoma
- Nasal cavity and paranasal sinuses
- Nasal cavity exophytic schneiderian papilloma
- Nasal cavity extranodal nk/t cell lymphoma
- Nasal cavity schneiderian papilloma, inverted type
- Nasal cavity schneiderian papilloma
- Nasal congestion and discharge
- Nasal congestion and rhinorrhea
- Nasal drops, emulsion
- Nasal drops, lyophilisate for suspension
- Nasal drops, powder and solvent for solution
- Nasal drops, powder for solution
- Nasal drops, solution in single-dose container
- Nasal drops, solution
- Nasal drops, suspension
- Nasal foreign bodies
- Nasal inhaler dose form
- Nasal lateral wall
- Nasal polyps
- Nasal powder in single dose container
- Nasal powder in single-dose container
- Nasal saline wash
- Nasal soft tissue
- Nasal spray, emulsion
- Nasal spray, lyophilisate for suspension
- Nasal spray, powder for solution
- Nasal spray, solution in single-dose container
- Nasal spray, solution/oromucosal solution
- Nasal spray, solution
- Nasal spray, suspension
- Nasal turbinate, dorsal concha
- Nasal turbinate, ethmoidal concha
- Nasal turbinate, middle concha
- Nasal turbinate, ventral concha
- Nasal type extranodal nk/t cell lymphoma
- Nasal/oromucosal solution
- Nasal/oromucosal spray, solution
- Nasal
- Nasalis
- Nash test
- Nash
- Nasion
- Nasmyth
- Nasoalveolar
- Nasobasilar
- Nasociliary
- Nasofrontal
- Nasogastric or intestinal intubation
- Nasogastric tube placement and feeding pediatric
- Nasogastric
- Nasolabial
- Nasolacrimal drainage system involvement (+/
- Nasolacrimal
- Nasomaxillary
- Nasopalatine
- Nasopharyngeal adenoid cystic carcinoma
- Nasopharyngeal biopsy
- Nasopharyngeal cancer pm0 tnm finding
- Nasopharyngeal cancer
- Nasopharyngeal carcinoma by ajcc v6 stage
- Nasopharyngeal carcinoma by ajcc v7 stage
- Nasopharyngeal hodgkin lymphoma
- Nasopharyngeal keratinizing epidermoid carcinoma
- Nasopharyngeal laryngoscopy
- Nasopharyngeal lymphoma
- Nasopharyngeal neoplasm, benign
- Nasopharyngeal non hodgkin lymphoma
- Nasopharyngeal non neoplastic disorder
- Nasopharyngeal pituitary gland adenoma
- Nasopharyngeal squamous cell carcinoma
- Nasopharyngeal swab test
- Nasopharyngeal teratoid polyp
- Nasopharyngeal throat nonkeratinizing cancer
- Nasopharyngeal throat papillary adenocarcinoma
- Nasopharyngeal wash
- Nasopharyngeal
- Nasopharyngitis
- Nasopharyngoscope
- Nasosinusitis
- Nasospinale
- Nasotracheal
- Nasotracheobronchial
- Nasoturbinate
- Nastiness
- Nat24 allele
- Natal
- Nati
- National Institute of Food and Agriculture
- National cancer burden
- National cancer institute terminology
- National coordinating investigator
- National detection research network
- National drug code gram
- National drug code milligram
- National drug code milliliter
- National drug code unit of measure
- National guard
- National park service
- National socialism
- National wilms tumor study group staging system
- National
- Nationalistic
- Nationhood
- Native antigen receptor
- Natriuretic peptide a gene
- Natriuretic peptide precursor b gene
- Natriuretic peptide receptor a/guanylate cyclase a
- Natural cytotoxicity triggering receptor 1 gene
- Natural cytotoxicity triggering receptor 2 gene
- Natural cytotoxicity triggering receptor 3 gene
- Natural cytotoxicity triggering receptor
- Natural family planning
- Natural grandchild
- Natural heart valve repair
- Natural history and cofactors
- Natural history group
- Natural human interferon beta
- Natural killer associated transcript 4 positive
- Natural killer cell activation
- Natural killer cell antigen cd94
- Natural killer cell function
- Natural killer cell granular protease
- Natural killer cell p30-related protein
- Natural killer cell p44-related protein
- Natural killer cell p46-related protein
- Natural killer cell stimulatory factor 2
- Natural killer cells cyclophilin related protein
- Natural killer t cell
- Natural killer triggering receptor gene
- Natural killer-associated transcript 4 positive
- Natural products chemistry
- Natural pruning
- Natural resources conservation
- Natural-killer cells cyclophilin-related protein
- Natural
- Naturist
- Naturopath
- Naturopathy
- Nausea and vomiting during early pregnancy
- Nausea and vomiting in adults
- Nausea and vomiting in infants and children
- Nausea and vomiting scale
- Nausea and vomiting
- Nausea frequency
- Nausea question
- Nausea scale
- Nausea severity
- Nausea
- Nauseant
- Navajo Indians
- Navel orange
- Navel
- Navelbine regimen
- Navicular
- Navy Blue
- Navy blue
- Naxe
- Nazi Germany
- Nazi Party
- Nb4 apoptosis/differentiation related protein
- Nbaf complex
- Nbd protein
- Nbd
- Nbk
- Nbmbmx
- Nbn
- Nbnl2ind
- Nbnlnum
- Nbtf
- Nc2 alpha
- Nc2 beta
- Ncab
- Ncadherin staining method
- Ncam1 expressing cell measurement
- Ncbaf
- Ncbi taxon id
- Nccf
- Nccn cytogenetic risk group for all, good risk
- Nccn cytogenetic risk group for all, poor risk
- Nccn cytogenetic risk group for all
- Nccn distress thermometer
- Nccr
- Ncgm
- Nci initial review group
- Nci ln1
- Nci ln2
- Nci ln3
- Nci meta cui
- Nci office of the director
- Nci organization
- Nci program (t, p, or n)
- Nci special emphasis panel
- Nci strategic plan to reduce health disparities
- Nci thesaurus entity
- Nci thesaurus kind
- Nci tissue expediter
- Ncic ctg
- Ncic
- Ncicb
- Nciprogramcode
- Ncit covid 19 agent terminology
- Ncit covid 19 terminology
- Nck2
- Nckipsd
- Ncmh
- Ncoa 5
- Ncorp
- Ncov antibody
- Ncov igm positive
- Ncov positive
- Ncov
- Ncpb
- Ncpdp doseunitofmeasure terminology
- Ncpdp quantityunitofmeasure terminology
- Ncpdp strengthform terminology
- Ncpdp terminology
- Ncr of multiple myeloma or plasma cell leukemia
- Ncrna seq (sequencing of non coding rna)
- Ncrna-seq (sequencing of non-coding rna)
- Ncstn protein variant
- Ncstn
- Nctd5p
- Ncvaltyp
- Ncym protein
- Nda authorized generic
- Ndba
- Ndc80, kinetochore complex component gene
- Ndea
- Ndela
- Ndf rt
- Ndf-rt
- Ndfrt code
- Ndfrt name
- Ndii
- Ndls
- Ndmtase
- Ndnc8 exon 73 mutation
- Ndnc8 gene mutation
- Ndor1
- Ndpa
- Ndrg1
- Ndri
- Neapolitan fat bombs
- Neapolitan mastiff
- Near diploid
- Near haploid
- Near infrared fluorescence imaging probe
- Near infrared imaging
- Near term infant
- Near-haploid
- Near-infrared imaging
- Near
- Nearly all the time
- Nearly daily
- Nearly every day for 2 weeks
- Nearly everyday
- Nearthrosis
- Nebivolol/en
- Nebivolol
- Nebuchadnezzar II
- Nebule
- Nebulisation solution
- Nebulisation use
- Nebuliser dispersion
- Nebulization
- Nebulizer
- Nec
- Necator
- Necatoriasis
- Necdin, melanoma antigen (mage) family member gene
- Neck and back pain
- Neck and low back pain
- Neck arthritis
- Neck computed tomography with contrast
- Neck ct with contrast
- Neck cup
- Neck edema
- Neck exercises
- Neck injuries and disorders
- Neck lump
- Neck lumps in children
- Neck lymph node boundary level iii
- Neck lymph node boundary level iv
- Neck lymph node boundary level vi
- Neck lymph node boundary level vii
- Neck lymph node boundary sublevel ia
- Neck lymph node boundary sublevel ib
- Neck lymph node boundary sublevel iia
- Neck lymph node boundary sublevel iib
- Neck lymph node boundary sublevel va
- Neck lymph node boundary sublevel vb
- Neck lymph node groups
- Neck lymph node levels I iv
- Neck lymph node levels I-iv
- Neck lymph node levels ii iv
- Neck lymph node levels ii-iv
- Neck mass
- Neck masses in children
- Neck mri with and without contrast
- Neck of the bladder
- Neck of the humerus, anatomical
- Neck pain visual analog scale
- Neck pain
- Neck
- Neckcir
- Necked
- Necml
- Necro/sis
- Necrobacillosis
- Necrobiosis
- Necrobiotic
- Necrogenic
- Necrolysis
- Necromantic
- Necromass
- Necrophile
- Necrophiliac
- Necrophobe
- Necrophobia
- Necropsy sample
- Necrose
- Necrosin
- Necrosis (y/n)
- Necrosis factor (TNF)
- Necrosis induction
- Necrosis/degeneration
- Necrosis/infiltrate
- Necrosis/inflammation
- Necrosis
- Necrospermia
- Necrotic uveal melanoma
- Necrotic
- Necrotizing deciduitis
- Necrotizing enterocolitis nec
- Necrotizing enterocolitis neonatal
- Necrotizing enterocolitis
- Necrotizing gastritis
- Necrotizing skin infections
- Necrotizing soft tissue infection
- Necrotizing
- Necrotomy
- Necrotoxin
- Nectin cell adhesion molecule 2 gene
- Nectin cell adhesion molecule 4 gene
- Necturus
- Nedd4 binding protein 2 gene
- Nedd4 binding protein 2 wt allele
- Nedd8 activating enzyme e1 subunit 1 gene
- Nedocromil
- Nee
- Need to be near a bathroom always
- Need to be near a bathroom most of the time
- Need to urinate frequently during the day
- Need
- Needle applicator
- Needle biopsy of the pleura or lung
- Needle free injection dosing unit
- Needle free injection
- Needle free injector
- Needle gauge
- Needle stick prevention mechanism
- Needle stick/puncture
- Needle sticks hurt
- Needle tract lesion
- Needle-free injector
- Needle
- Needs help (verbal, physical, carrying aid)
- Needs help with personal care
- Needs help with wheelchair transfer
- Needs help, but can do about half unaided
- Needs intensive care, seriously ill, moribund
- Needs some help, but can do something alone
- Neelsen
- Neencephalon
- Nefertiti
- Negationindicator
- Negationreason
- Negative breast carcinoma
- Negative cell selection
- Negative circumferential margin by mri
- Negative cobas taqscreen mpx test
- Negative cofactor 2 alpha
- Negative contrast agent
- Negative differentiation regulator protein
- Negative elongation factor complex member b gene
- Negative elongation factor complex member c/d gene
- Negative elongation factor complex member e gene
- Negative elongation factor protein b
- Negative for gastric intraepithelial neoplasia
- Negative for malignancy/normal/benign
- Negative for neoplasia
- Negative infinity
- Negative integer value
- Negative pregnancy test
- Negative pressure wound therapy
- Negative regulation of cell proliferation
- Negative schumm's test
- Negative sense, single-stranded RNA viruses
- Negative skin test
- Negative small cell sarcoma
- Negative
- Negatively charged
- Negativistic
- Negativity scale score
- Negativity
- Neglect in older adults
- Neglect
- Negri
- Negro Pepper
- Nehi
- Nei endonuclease viii-like 3 (e. Coli) gene
- Nei-like dna glycosylase 1 gene
- Neigh
- Neighborhood disadvantage
- Neighbors or groups
- Neisseria elongata subsp. Nitroreducens
- Neisseria gonorrhoeae measurement
- Neisseria gonorrhoeae, beta-lactamase negative
- Neisseria gonorrhoeae, beta-lactamase positive
- Neisseria gonorrhoeae, penicillinase negative
- Neisseria gonorrhoeae, penicillinase positive
- Neisseria
- Neisseriaceae
- Neisserian
- Neither good or bad
- Nelfinavir
- Nell Gwynne
- Nemathelminth
- Nemathelminthes
- Nematocidal
- Nematocide
- Nematoda
- Nematode
- Nematodes roundworms
- Nematodes
- Nematodiasis
- Nematodiriasis
- Nematodirus
- Nematologist
- Nematomorpha
- Nembutalized
- Nemic
- Nemo like kinase gene
- Nenets
- Neo-Darwinism
- Neo-Lamarckism
- Neo-adjuvant
- Neo-antigen peptide
- Neo-masct
- Neoangiogenesis
- Neoantigen peptide antibody
- Neoantigen positive malignant solid tumor
- Neoantigen positive
- Neoantigen-positive malignant solid tumor
- Neoarsphenamine
- Neob
- Neoblastic
- Neocerebellar
- Neocerebellum
- Neocinchophen
- Neocosmospora solani
- Neoepitope based immunotherapeutic adxs neo
- Neoepitope-based immunotherapeutic adxs-neo
- Neoformation
- Neogenetic
- Neogenin 1 gene
- Neogenin homolog 1 (chicken) gene
- Neogenin homolog 1
- Neohesperidin
- Neointima
- Neomorph
- Neomycin a
- Neomycin b sulphate
- Neomycin resistance gene
- Neonat/e
- Neonatal abstinence syndrome assessment result
- Neonatal adverse event
- Neonatal bacterial meningitis
- Neonatal birth injury
- Neonatal bradyarrhythmia
- Neonatal breast enlargement
- Neonatal cholestasis
- Neonatal coagulation disorder, adverse event
- Neonatal complications
- Neonatal conjunctivitis
- Neonatal constipation, adverse event
- Neonatal convulsion
- Neonatal culture negative sepsis, adverse event
- Neonatal culture positive sepsis, adverse event
- Neonatal death level of diagnostic certainty
- Neonatal diarrhea, adverse event
- Neonatal edema, adverse event
- Neonatal epileptic seizure
- Neonatal fever, adverse event
- Neonatal gasping syndrome
- Neonatal gastrointestinal bleeding, adverse event
- Neonatal hepatitis b virus hbv infection
- Neonatal herpes simplex virus hsv infection
- Neonatal hie
- Neonatal hospital acquired infection
- Neonatal hyperbilirubinemia
- Neonatal hypercalcemia
- Neonatal hyperglycemia
- Neonatal hypernatremia
- Neonatal hypertension, adverse event
- Neonatal hypocalcemia
- Neonatal hypoglycemia
- Neonatal hyponatremia
- Neonatal infections level of diagnostic certainty
- Neonatal intraventricular hemorrhage, adverse event
- Neonatal jaundice
- Neonatal leukemia
- Neonatal leukopenia
- Neonatal listeriosis
- Neonatal narcotic withdrawal syndrome
- Neonatal opioid withdrawal syndrome
- Neonatal pneumonia
- Neonatal pneumothorax
- Neonatal pulmonary hamartoma
- Neonatal respiratory insufficiency
- Neonatal resuscitation
- Neonatal seizure disorders
- Neonatal sepsis
- Neonatal sinus bradycardia
- Neonatal sinus tachycardia
- Neonatal spells
- Neonatal spontaneous intestinal perforation
- Neonatal tachyarrhythmia
- Neonatal
- Neonate
- Neonates
- Neonatologist
- Neonicotinoid insecticides
- Neopallial
- Neopallium
- Neophobia
- Neopine
- Neoplas/ia
- Neoplasia
- Neoplasias
- Neoplasm antigens
- Neoplasm progression
- Neoplasm proteins
- Neoplasm, uncertain whether benign or malignant
- Neoplasms, cerebellar, benign
- Neoplasms, infratentorial
- Neoplasms
- Neoplastic Conversion
- Neoplastic cell transformation
- Neoplastic eosinophilic spindle cell
- Neoplastic nodule
- Neoplastic plasma cells present in bone marrow
- Neoplastic polyp
- Neoplastic status
- Neosho
- Neostriatum
- Neotcr-p1 t-cells
- Neothalamus
- Neovascular
- Neovascularization
- Neovasculature
- Neovax melanoma vaccine
- Neovax renal cell carcinoma vaccine
- Neoviderm
- Nepetalactone
- Nephelium
- Nephelometry
- Nephralgia
- Nephrectomize
- Nephritic
- Nephritis
- Nephritogenic
- Nephroblastoma, benign
- Nephrocalcinosis
- Nephrocapsectomy
- Nephrocoel
- Nephrocystin-7 gene
- Nephrogenesis
- Nephrogenic diabetes insipidus
- Nephrogenic ridge
- Nephrogenic
- Nephrogram
- Nephrography
- Nephrolithiasis
- Nephrolithotomy
- Nephrologist
- Nephrolysis
- Nephroma
- Nephromere
- Nephronophthisis 1 (juvenile) gene
- Nephronophthisis
- Nephropathies
- Nephropathy
- Nephropexy
- Nephroprotective agents
- Nephroptosis
- Nephrorrhaphy
- Nephrosclerosis
- Nephroscope
- Nephrostogram
- Nephrostomy
- Nephrotic syndrome - glepp1 associated
- Nephrotic syndrome
- Nephrotic
- Nephrotome
- Nephrotomogram
- Nephrotomography
- Nephrotomy
- Nephrotoxin
- Nephroureterectomy with cuff of bladder
- Nepidae
- Neprilysin antibody
- Neprilysin expressing cell count
- Nerlynx capecitabine
- Nerlynx regimen
- Nerlynx-capecitabine
- Nernst
- Nerofe
- Nerve and muscle biopsy
- Nerve cell survival
- Nerve chemical warfare agents
- Nerve growth factor (beta polypeptide) gene
- Nerve growth factor (beta polypeptide) wt allele
- Nerve growth factor mimetic
- Nerve root disorders
- Nerve sheath tumor, not otherwise specified
- Nerve sparing surgery
- Nerve tissue and nerve sheaths
- Nerve(s) cranial
- Nerve, caudal plexus
- Nerve, fibular
- Nerve, median
- Nerve, peroneal, common
- Nerve, peroneal, deep
- Nerve, peroneal, superficial
- Nerve, plantar
- Nerve, saphenous
- Nerve, sural
- Nerve, tibial
- Nerve
- Nerves
- Nervi
- Nervine
- Nerving
- Nervon
- Nervonic
- Nervosa
- Nervous system findings
- Nervous system fluids and secretions
- Nervous system neoplasm, benign
- Nervous system neoplasms, malignant
- Nervous system, brain
- Nervous system, ear
- Nervous system, eye
- Nervous system-fluids, secretions
- Nervous
- Nervus
- Nesol
- Nesselrode Pudding
- Nesselrode pudding
- Nesselrode
- Nessler
- Nesslerize
- Nested case control study
- Nested proliferation
- Nestedness
- Nestin gene
- Nestin wt allele
- Nestlings
- Nestmate recognition
- Net ecosystem exchange
- Net ecosystem production
- Net farm income
- Net head
- Nether region
- Netherworld
- Neti
- Netrin 1 gene
- Netrin 1 homolog
- Netrin 1, mouse, homolog of gene
- Netrin g1 gene
- Network communication problem
- Network endpoint
- Network interface
- Neu areas brain
- Neu arteries brain
- Neu autonomic nervous system labels
- Neu autonomic nervous system
- Neu basal ganglia
- Neu brain activity normal
- Neu brain activity seizure a
- Neu brain activity seizure b
- Neu brain damage
- Neu brain herniation
- Neu brain lobes pv
- Neu brain move muscle periph
- Neu bursts breaks stroke
- Neu cauda equina
- Neu clots clogs stroke
- Neu cranial nerves
- Neu cutaneous nerve lower
- Neu cutaneous nerve upper
- Neu dermatomes
- Neu homunculus
- Neu hyperkinesias
- Neu insulating nerve ms
- Neu low expressing
- Neu lumbar puncture
- Neu mallampati snoring sketch
- Neu metoclopramide
- Neu negative by fish
- Neu negative by immunohistochemistry
- Neu nerve cell
- Neu neurotransmission
- Neu pain scales
- Neu plexuses pe
- Neu plexuses periph
- Neu positive by fish
- Neu positive by immunohistochemistry
- Neu referred pain
- Neu reflex arc
- Neu sleep pattern
- Neu sleep stages
- Neu spinal cord damage ai resize
- Neu spinal nerve updated eb
- Neu spine organized a
- Neu spine organized b qf
- Neu spine organized b
- Neu status by validated dual probe ish
- Neu status by validated single probe ish
- Neu strokes one side
- Neu supplying brain blood stroke
- Neu taking pressure off nerve cranial
- Neu testing by validated immunohistochemistry
- Neu to from spinal cord a
- Neu to from spinal cord b
- Neu viewing the brain a
- Neu viewing the brain b
- Neu-metoclopramide
- Neu
- Neulasta regimen
- Neumune
- Neupogen regimen
- Neural Synapse
- Neural cell adhesion molecule 1 gene
- Neural cell adhesion molecule 1 negative
- Neural cell adhesion molecule 1 positive
- Neural cell adhesion molecule 1 wt allele
- Neural cell adhesion molecule 2 gene
- Neural cell adhesion molecule 2 wt allele
- Neural crest tumor, benign
- Neural drug delivery systems
- Neural egfl like 1 gene
- Neural egfl like 1 wt allele
- Neural endopeptidase induced membranous nephropathy
- Neural growth/development/degeneration
- Neural networks (computer)
- Neural nevus
- Neural peptide receptor
- Neural tube defects and spina bifida
- Neural tube defects ntds
- Neural zinc finger transcription factor 1 gene
- Neural
- Neuralgia
- Neuralgiform
- Neuralized e3 ubiquitin protein ligase 1 gene
- Neuraminic
- Neuraminidase inhibition assay
- Neurapraxia
- Neurasthenic
- Neuraxial opioid analgesia
- Neuraxon
- Neurectoderm
- Neurectomy
- Neuregulin 1 gene
- Neuregulin 2 gene
- Neuregulin 2 wt allele
- Neuregulin 3 gene
- Neuregulin positive
- Neurenteric
- Neurergic
- Neurexin 1 alpha
- Neurexin 1 gene
- Neurexin 1 isoform 1b
- Neurexin 2 gene
- Neurexin 2 wt allele
- Neurexin 3 gene
- Neurexin 3 wt allele
- Neurexin iii-beta
- Neurexin-2 isoform 1b
- Neurexin-2-alpha
- Neurexin-3-alpha
- Neurilemmoma
- Neurility
- Neurine
- Neurite
- Neuritis
- Neuro oncologic ventral antigen 2 gene
- Neuro oncological ventral antigen 1 gene
- Neuro oncology
- Neuro ophthalmologic and cranial nerve disorders
- Neuro ophthalmology
- Neuro otology
- Neuro qol adult self reported mental health domain
- Neuro qol cognitive function subdomain
- Neuro qol
- Neuro trauma icu stay
- Neuro-d4, rat, homolog of gene
- Neuro-oncologic ventral antigen 2 gene
- Neuro-oncological ventral antigen 1 gene
- Neuro-qol
- Neuro-trauma icu stay
- Neuro
- Neuroanatomist
- Neuroaugmentation techniques
- Neurobeachin gene
- Neurobeachin wt allele
- Neurobehavioral
- Neurobiofeedback
- Neurobiologist
- Neurobiotaxis
- Neuroblast
- Neuroblastoma amplified protein
- Neuroblastoma amplified sequence gene
- Neuroblastoma of the retina
- Neuroblastoma ras viral oncogene homolog
- Neuroblastoma risk group
- Neuroblastoma screening
- Neuroblastoma
- Neuroborreliosis
- Neurocentrum
- Neurochemist
- Neurocirculatory
- Neurocoele
- Neurocognitive assessment
- Neurocognitive disturbance
- Neurocognitive
- Neurocranium
- Neurocutaneous melanocytosis
- Neurocutaneous syndromes in children
- Neurocutaneous syndromes
- Neurocutaneous
- Neurocysticercosis
- Neurocyte
- Neurocytology
- Neurocytolysin
- Neurocytoma
- Neurod1-associated monogenic diabetes
- Neurodermatitic
- Neurodermatitis
- Neurodermatosis
- Neurodevelopment
- Neurodiagnostic
- Neurodynamic
- Neuroectoderm
- Neuroectodermal cell
- Neuroeffector
- Neuroelectric
- Neuroembryologist
- Neuroembryology
- Neuroendocrine carcinoma of the ampullary region
- Neuroendocrine carcinoma, excluding head and neck
- Neuroendocrine carcinoma, nos
- Neuroendocrine cell tumor, benign
- Neuroendocrine cell tumor, malignant
- Neuroendocrine neoplasm of the ampullary region
- Neuroendocrine tumor g1 of the ampullary region
- Neuroendocrine tumor g2 of the ampullary region
- Neuroendocrine tumor of the ampullary region
- Neuroendocrine tumor, well differentiated
- Neuroendocrinologist
- Neuroengineering
- Neuroepithelial tissue
- Neuroepithelial
- Neuroepithelioma
- Neuroepithelium
- Neurofeedback
- Neurofibroma of spinal cord
- Neurofibromatosis aggravated
- Neurofibromatosis, nos
- Neurofibromatosis
- Neurofibromin 1 c.4394a g
- Neurofibromin 1 c.6926del
- Neurofibromin 1 gene deletion
- Neurofibromin 1 gene mutation
- Neurofibromin 1 gene
- Neurofibromin 1 mutation analysis
- Neurofibromin 2 gene
- Neurofibromin gene rearrangement
- Neurofibromin n1465s
- Neurofibromin positive
- Neurofibromin protein variant
- Neurofibrosarcoma
- Neurofilament h
- Neurofilament l
- Neurofilament light gene
- Neurofilament m
- Neurofilament, heavy polypeptide gene
- Neurofilament, heavy polypeptide wt allele
- Neurofilament, medium polypeptide gene
- Neurofilament, medium polypeptide wt allele
- Neurofilament
- Neurogen
- Neurogenesis
- Neurogeneticist
- Neurogenetics
- Neurogenic appendicopathy
- Neurogenic arthropathy
- Neurogenic bladder
- Neurogenic differentiation 1 gene
- Neurogenic
- Neurogenin 1 gene
- Neuroglandular
- Neuroglial heterotopia
- Neurogram
- Neurography
- Neurohistologist
- Neurohistology
- Neurohypophyseal
- Neuroid
- Neuroimmunology
- Neurojungin
- Neurokeratin
- Neurokyme
- Neuroleptanalgesia
- Neuroleptic malignant syndrome
- Neuroleptic
- Neuroligin 4, x linked gene
- Neurolin
- Neurolinguistics
- Neurologic disorders in children
- Neurologic disorders
- Neurologic examination
- Neurologic process
- Neurologic tests and procedures
- Neurologic
- Neurological model
- Neurological signs and symptoms
- Neurological
- Neurology other
- Neurology, pediatric
- Neurolymphomatosis
- Neurolysis
- Neurolytic
- Neuroma
- Neuromalacia
- Neuromechanism
- Neuromedin b gene
- Neuromedin b preferring bombesin receptor
- Neuromedin b receptor gene
- Neuromedin b wt allele
- Neuromedin c gene
- Neuromedin c
- Neuromedin u gene
- Neuromedin-beta
- Neuromelanin
- Neuromere
- Neurometrics
- Neuromimesis
- Neuromodulator
- Neuromotor
- Neuromuscular
- Neuromyelitis optica nmo
- Neuromyelitis optica spectrum disorder nmosd
- Neuromyelitis
- Neuromyoblastoma, malignant
- Neuromyopathy
- Neuromyositis
- Neuron conduction induction
- Neuron-specific enolase measurement
- Neuron-specific enolase negative
- Neuron-specific enolase positive
- Neuron
- Neuronal cell adhesion molecule gene
- Neuronal ceroid lipofuscinosis, parry type
- Neuronal gene
- Neuronal growth
- Neuronal krueppel like protein
- Neuronal krueppel-like protein
- Neuronal nicotinic receptor beta 4 subunit gene
- Neuronal nicotinic receptor beta 4 subunit
- Neuronal tissue enriched acidic protein
- Neuronal tissue-enriched acidic protein
- Neuroneuronal
- Neuronevus
- Neuronitis
- Neuronography
- Neuronophagia
- Neuronotropic
- Neurooncologic ventral antigen 2 gene
- Neurooncological ventral antigen 2
- Neuroparalytic
- Neuropath
- Neuropathic pain
- Neuropathic
- Neuropathies
- Neuropathogenesis
- Neuropathogenic
- Neuropathologist
- Neuropathy
- Neuropeptide precursor gene
- Neuropeptide y gene
- Neuropeptide y receptor y1 gene
- Neuropeptide y receptor y1 wt allele
- Neuropeptide y receptor y2 gene
- Neuropeptide y receptor y2 wt allele
- Neuropeptide y receptor y5 gene
- Neuropeptide y receptor y5 wt allele
- Neuropeptide
- Neuropharmaceutical
- Neuropharmacologist
- Neuropharmacology / toxicology
- Neurophysin
- Neurophysiologist
- Neurophysiology / electrophysiology
- Neuropil
- Neuropilin 1 gene
- Neuropilin 2 gene
- Neuroplasm
- Neuroplastic
- Neuroplegic
- Neuropodium
- Neuropoietic cytokine
- Neuropore
- Neuroprotectant
- Neuroprotective drugs
- Neuropsychiatric inventory questionnaire
- Neuropsychiatric inventory-questionnaire
- Neuropsychiatrist
- Neuropsychic
- Neuropsychological examination
- Neuropsychological problems
- Neuropsychologist
- Neuropsychopharmacology
- Neuropsychotoxicology
- Neuroradiologist
- Neurorelapse
- Neuroretinitis
- Neurorrhaphy
- Neuroscience nursing
- Neurosciences research
- Neuroscientist
- Neurosensory disorder
- Neurosome
- Neurostimulator
- Neurosurgeon
- Neurosurgery/en
- Neurosurgery
- Neurosyphilis
- Neurosyphilitic
- Neurotendinous
- Neurotensin gene
- Neurotensin receptor 1 gene
- Neurotensin receptor 1 wt allele
- Neurotensin receptor type 1 positive
- Neurotensin wt allele
- Neurotensin
- Neurotherapy
- Neurotogenic
- Neurotomy
- Neurotoxic chemotherapy
- Neurotoxic
- Neurotoxicologist
- Neurotoxicology
- Neurotransmission
- Neurotrauma
- Neurotrope
- Neurotrophic receptor tyrosine kinase 1 gene
- Neurotrophic receptor tyrosine kinase 3 gene
- Neurotrophic tyrosine kinase receptor 2 gene
- Neurotrophic
- Neurotrophin 3 gene
- Neurotrophin 3 wt allele
- Neurotropism
- Neurotubule
- Neurovaccine
- Neurovaccinia
- Neurovascular disorder
- Neurovascular
- Neurovegetative
- Neurovirology
- Neurovirulence
- Neurovisceral
- Neurturin gene
- Neutagr
- Neutcybs
- Neutered indicator
- Neuthygr
- Neutimle
- Neutls
- Neutral fetal attitude
- Neutral oil
- Neutral
- Neutralizing anti drug antibodies
- Neutralizing anti-drug antibodies
- Neutralizing antibodies
- Neutralizing binding antidrug antibody
- Neutralizing g17 hormone
- Neutroclusion
- Neutrogin
- Neutropenia attenuation
- Neutropenia
- Neutrophil activation
- Neutrophil adherence receptor alpha-m subunit
- Neutrophil azurocidin gene
- Neutrophil count 1000 per cubic millimeter
- Neutrophil count 500 per cubic millimeter
- Neutrophil count decreased
- Neutrophil cytoplasmic ab, atypical
- Neutrophil cytoplasmic ab, classic
- Neutrophil cytosolic factor 2 gene
- Neutrophil elastase, polymorphonuclear
- Neutrophil expressed gene
- Neutrophil rich hepatocellular carcinoma
- Neutrophil/cd4+ lymphocyte ratio
- Neutrophilia
- Neutrophilic leukocytosis
- Neutrophilic toxic change
- Neutrophilic
- Neutrophils band form/ neutrophils
- Neutrophils band form/leukocytes
- Neutrophils, segmented + band form + precursors
- Neutrophils, segmented + band form
- Neutrophils, segmented/leukocytes
- Neutrophils, segmented/neutrophils
- Neutrophils/leukocytes
- Neutrophils/lymphocytes
- Neutrophils/non-squam epi cells
- Neutrophils/total cells
- Never affects sleep
- Never dosed
- Never marketed
- Never married status
- Never used
- Nevocarcinoma
- Nevoid cutaneous (skin) melanoma
- Nevoid
- Nevus araneus
- Nevus of acral skin
- Nevus of flexural skin
- Nevus of head and neck
- Nevus of the breast
- Nevus of the conjunctiva
- Nevus of the eyelid
- Nevus of the iris
- Nevus syringoadenomatosus papilliferum
- Nevus with dermal epithelioid component
- Nevus
- New England clam chowder
- New England region
- New Englander
- New Haven
- New Zealand spinach
- New active ingredient
- New animal drug application
- New anterior wall myocardial infarction
- New anterolateral wall myocardial infarction
- New anteroseptal wall myocardial infarction
- New bone lesion
- New component of brcaa1 a complex gene
- New component of the brcaa1 a complex
- New edition
- New event after initial treatment
- New extensive anterior wall myocardial infarction
- New guinean
- New high lateral wall myocardial infarction
- New index
- New inferior wall myocardial infarction
- New lateral wall myocardial infarction
- New lesion
- New loss of viable myocardium
- New myocardial infarction by ekg finding
- New non measurable lesion
- New non-index
- New objective column
- New or unknown interferent
- New or worsening symptoms
- New prevention strategies against disease
- New primary tumor, specify
- New regional wall motion abnormality
- New reservoir
- New septal wall myocardial infarction
- New tumor additional surgery date
- New tumor additional surgery performed
- New tumor confirmed
- New tumor event after initial treatment
- New tumor event date
- New tumor event
- New york strip
- New zealand hybrid
- New
- Newace
- Newari
- Newbie
- Newborn screening terminology
- Newborn screening tests
- Newborn screening
- Newborn
- Newborns
- Newby
- Newcastle-upon-Tyne
- Newlind
- Newlprog
- Newlwind
- Newqwave
- News agency
- News item
- News list
- News104a
- News2 clinical classification question
- News
- Newsboy
- Newspaper article
- Newsstand
- Newswoman
- Newton
- Nexus junction
- Nf l
- Nf m
- Nf1 mutant mpnst
- Nf1 mutational analysis performed
- Nf1 mutational analysis testing method
- Nf1 tumor suppressor gene inactivation
- Nf2 tumor suppressor gene inactivation
- Nfbd1 gene mutation
- Nfe1 exon 2 mutation
- Nfe1 exon 3 mutation
- Nfe1 gene mutation
- Nfe1b gene mutation
- Nfe1b
- Nfkbid
- Nfkbiz
- Ng/dl
- Ng/ml/(kg/m2)
- Ng/ml/(mg/cm2)
- Ng/ml/(ug/kg)
- Ng/ml/(ug/kg/d)
- Ng/ml/g
- Ng/ml/h
- Ng/ml/ug
- Ng/well
- Ngap-like protein
- Ngeq/l
- Ngeq/ml/mgeq
- Ngf mrd
- Ngf-mrd
- Ngfrap1
- Ngh/ml/(mg/kg/day)
- Ngobln
- Ngoblp
- Nhanes taste and smell section
- Nhej1-scid
- Nhlbi cad grade
- Nhoid
- Nhp2 ribonucleoprotein gene
- Nhpt functional test question
- Niacin deficiency
- Niacin toxicity
- Niacin
- Niagara Falls
- Nibrin gene
- Nicardipine
- Nicastrin ala572gly
- Nicastrin gene mutation
- Nicastrin gene
- Nich
- Nichd terminology
- Niche conservatism
- Nickel metabolic disorder
- Nickel method
- Nickel silver
- Nickel(ii) hydroxide
- Nickelous chloride
- Nickelous oxide
- Nicker nut
- Nicking
- Nicklaus
- Nicollea
- Nicotinamide n methyltransferase gene
- Nicotinamide n methyltransferase wt allele
- Nicotinamide n-methyltransferase gene
- Nicotinamide n-methyltransferase wt allele
- Nicotinate
- Nicotine derived nitrosamine ketone
- Nicotine metabolite ratio
- Nicotine replacement therapy agent
- Nicotine-derived nitrosamine alcohol
- Nicotine-derived nitrosamine ketone metabolite
- Nicotinism
- Nicotinuric
- Nidal
- Nidation
- Nidogen 1 gene
- Nidogen 1 wt allele
- Nidogen 1
- Nidogen 2 (osteonidogen) gene
- Nidogen 2 (osteonidogen) wt allele
- Nidularia
- Niece second degree relative
- Niemann pick disease
- Niemann pick
- Niemann
- Nifedipine/en
- Niff
- Niffy
- Nifuroxime
- Nigella sativa blackseed oil
- Night Shift
- Night sweating
- Night terrors
- Night
- Nigral
- Nigrostriatal
- Nih 3t3 cells
- Nih cgvhd consensus project response criteria
- Nih emphasis area
- Nih national research service award for individual
- Nih sla miniature swine
- Nih toolbox
- Nih, grants and contracts
- Nih
- Nihilistic
- Niid
- Niikawa-kuroki syndrome
- Nik related kinase gene
- Nikethamide
- Nilandron regimen
- Nile
- Nim ha conjugate
- Nim-ha conjugate
- Nima (never in mitosis gene a)
- Nima related kinase 1 gene
- Nima related kinase 10 gene
- Nima related kinase 2 gene
- Nima-related kinase 3 gene
- Nima-related kinase 3 wt allele
- Nimbus
- Nimodipine
- Nine hole peg test functional test test code
- Nine hole peg test functional test test name
- Nine-hole peg test functional test test code
- Nine-hole peg test functional test test name
- Ninein (gsk3b interacting protein) gene
- Ninepence
- Ninepin
- Nineties
- Ninety-nine
- Ninhydrin
- Ninlaro regimen
- Ninlaro/dexamethasone
- Ninlaro/revlimid/dexamethasone
- Ninon
- Niobrara
- Nipa palm
- Nipah
- Nipped b homolog (drosophila) gene
- Nipped b homolog (drosophila) wt allele
- Nipple discharge
- Nipple duct carcinoma
- Nipple sensation changes
- Nipple
- Nippostrongylus
- Nipride
- Nir fluorescence endoscopy
- Nir optical imaging
- Nischarin gene
- Nischarin wt allele
- Nisin
- Nissen fundoplication
- Nissen
- Nissl
- Nitabuch's fibrinoid
- Nithiamide
- Nitraphen
- Nitration of tyrosine
- Nitric acid measurement
- Nitric oxide breath test
- Nitric oxide synthase 1 (neuronal) gene
- Nitric oxide synthase 2, inducible gene
- Nitric oxide synthase 2b gene
- Nitric oxide synthase 2b wt allele
- Nitric oxide synthase 2c gene
- Nitric oxide synthase 2c wt allele
- Nitric oxide synthase 3 (endothelial cell) gene
- Nitric oxide synthase iib
- Nitric oxide synthase iic
- Nitric
- Nitridation
- Nitrilase 1 gene
- Nitrilase 1 wt allele
- Nitrites
- Nitritoid
- Nitro group
- Nitroarenes
- Nitroaromatic compounds
- Nitrobenzoic acids
- Nitrocarbol
- Nitrocefin
- Nitrofurantoin/en
- Nitrofurantoin
- Nitrofurazone
- Nitrogen mustard compound
- Nitrogen-fixing trees
- Nitrogen
- Nitroglycerin - citrate - ethanol
- Nitromersol
- Nitrometer
- Nitron
- Nitroprusside
- Nitrosamine metabolism
- Nitrosate
- Nitrosation
- Nitroso carcinogen
- Nitroso
- Nitrosoguanidine
- Nitrosourea
- Nitrosyl
- Nitrous acid, ion(1-)
- Nitroxidergic neurons
- Nitryl
- Nitzschia
- Nivolumab/ipilimumab
- Nix gene
- Nizatidine
- Nk cell-enriched allogeneic lymphocytes
- Nk-92/5.28.Z cells
- Nk3 receptor antagonist
- Nkat/l
- Nkat1 polymorphism positive
- Nkg2-a/nkg2-b/nkg2-c
- Nkg2-c-activating nk receptor
- Nkg2-d-activating nk receptor
- Nkg2a
- Nkg2c
- Nkg2d/akt-expressing cd8-positive t-cells
- Nkg2d
- Nkp44l
- Nkts
- Nkundo
- Nkx2 8
- Nkx2h
- Nkx3 1
- Nkx3a
- Nlgase
- Nli
- Nlmd
- Nlr family, apoptosis inhibitory protein gene
- Nls
- Nm 000041.2:c.388t c,526c c
- Nm 000077.4:c.151g a
- Nm 000077.4:c.152t a
- Nm 000077.4:c.247c t
- Nm 000077.4:c.248 249delacinsct
- Nm 000077.4:c.248a c
- Nm 000077.4:c.305c t
- Nm 000077.4:c.322g c
- Nm 000077.4:c.322g t
- Nm 000077.4:c.389t a
- Nm 000077.4:c.439g a
- Nm 000077.4:c.442g a
- Nm 000077.4:c.89c t
- Nm 000110.3:c.1627a g
- Nm 000141.4:c.1115c g
- Nm 000141.4:c.1124a g
- Nm 000141.4:c.1144t c
- Nm 000141.4:c.1645a c
- Nm 000141.4:c.1647t a
- Nm 000141.4:c.1647t g
- Nm 000141.4:c.1975a g
- Nm 000141.4:c.755c g
- Nm 000141.4:c.758c g
- Nm 000142.4:c.1108g t
- Nm 000142.4:c.1111a t
- Nm 000142.4:c.1118a g
- Nm 000142.4:c.1138g a
- Nm 000142.4:c.1948a g
- Nm 000142.4:c.742c t
- Nm 000142.4:c.746c g
- Nm 000516.5:c.374a g
- Nm 000516.5:c.478c t
- Nm 000516.5:c.601c a
- Nm 000516.5:c.601c t
- Nm 000516.5:c.602g a
- Nm 000516.5:c.679c g
- Nm 000516.5:c.680a g
- Nm 000516.5:c.680a t
- Nm 000518.4:c.20a t
- Nm 000518.4:c.364g a
- Nm 000518.5:c.19g a
- Nm 000795.3:c.-486 -485insc
- Nm 000795.3:c.957c t
- Nm 001098209.2:c.121a g
- Nm 001904.4:c.110c t
- Nm 001904.4:c.133t c
- Nm 001904.4:c.134c t
- Nm 002107.4:c.83a t
- Nm 002168.3:c.418c g
- Nm 002168.3:c.418c t
- Nm 002168.3:c.419g a
- Nm 002168.3:c.419g t
- Nm 002168.3:c.514a g
- Nm 002168.3:c.514a t
- Nm 002168.3:c.515 516delgginsaa
- Nm 002168.3:c.515g a
- Nm 002168.3:c.515g t
- Nm 002168.3:c.516g c
- Nm 002168.3:c.516g t
- Nm 002468.4:c.794t c
- Nm 003530.4:c.83a t
- Nm 003531.2:c.83a t
- Nm 003537.3:c.83a t
- Nm 004048.3:c.2t g
- Nm 004119.2:c.1727t g
- Nm 004119.2:c.1775t c
- Nm 004119.2:c.1775t g
- Nm 004119.2:c.1796a g
- Nm 004119.2:c.1992g a
- Nm 004119.2:c.1992g c
- Nm 004119.2:c.1992g t
- Nm 004119.2:c.2027a g
- Nm 004119.2:c.2028c a
- Nm 004119.2:c.2028c g
- Nm 004119.2:c.2039c t
- Nm 004119.2:c.2073t a
- Nm 004119.2:c.2516a g
- Nm 004119.2:c.2517t a
- Nm 004119.2:c.2525a g
- Nm 004304.4:c.3185a t
- Nm 004304.4:c.3383g c
- Nm 004304.4:c.3497t g
- Nm 004304.4:c.3509t a
- Nm 004304.4:c.3509t g
- Nm 004304.4:c.3512 3513deltcinsat
- Nm 004304.4:c.3512t a
- Nm 004304.4:c.3520t c
- Nm 004304.4:c.3520t g
- Nm 004304.4:c.3521t g
- Nm 004304.4:c.3522c a
- Nm 004304.4:c.3522c g
- Nm 004304.4:c.3575g c
- Nm 004304.4:c.3586c a
- Nm 004304.4:c.3733t a
- Nm 004304.4:c.3733t c
- Nm 004304.4:c.3735c a
- Nm 004304.4:c.3735c g
- Nm 004304.4:c.3824g a
- Nm 004972.3:c.1848 1849deltginsct
- Nm 004972.3:c.1849g t
- Nm 004972.3:c.2047a g
- Nm 004972.3:c.2624c a
- Nm 004972.3:c.2792a g
- Nm 005228.2:c.2499g t
- Nm 005228.3:c.1474a c
- Nm 005228.3:c.1476c a
- Nm 005228.3:c.1793g t
- Nm 005228.3:c.2125 2129delgaaac
- Nm 005228.3:c.2153t a
- Nm 005228.3:c.2154 2155delgginstt
- Nm 005228.3:c.2156delg
- Nm 005228.3:c.2219 2220instcccgtcgctattaaaat
- Nm 005228.3:c.2231 2232instaaaattcccgtcgctat
- Nm 005228.3:c.2232 2233insaaaattcccgtcgctatc
- Nm 005228.3:c.2234 2236delagg
- Nm 005228.3:c.2235 2249delggaattaagagaagc
- Nm 005228.3:c.2236 2237insttcccgtcgctatcaagg
- Nm 005228.3:c.2236 2253delgaattaagagaagcaaca
- Nm 005228.3:c.2239 2247delttaagagaa
- Nm 005228.3:c.2239 2256delttaagagaagcaacatct
- Nm 005228.3:c.2240 2254deltaagagaagcaacat
- Nm 005228.3:c.2254 2277deltctccgaaagccaacaaggaaatc
- Nm 005228.3:c.2283 2284insgaagccttccag
- Nm 005228.3:c.2298 2299insgccata
- Nm 005228.3:c.2302 2303inscgctggcca
- Nm 005228.3:c.2302 2303instccaggaagcct
- Nm 005228.3:c.2303 2304instgtggccag
- Nm 005228.3:c.2303g t
- Nm 005228.3:c.2307 2308insatggccagcgtggac
- Nm 005228.3:c.2307 2308insgacaacgtg
- Nm 005228.3:c.2307 2308insgccagcgtg
- Nm 005228.3:c.2307 2308instgcgtg
- Nm 005228.3:c.2308 2309insacggcg
- Nm 005228.3:c.2308 2309insccagcgtgg
- Nm 005228.3:c.2308 2309insgcagcgtgg
- Nm 005228.3:c.2308 2309insgggtcgtgg
- Nm 005228.3:c.2309 2310delacinsccagcgtggat
- Nm 005228.3:c.2309 2310insatggccagcgtgga
- Nm 005228.3:c.2310 2311insaac
- Nm 005228.3:c.2310 2311insaacccccac
- Nm 005228.3:c.2310 2311insagcgtggac
- Nm 005228.3:c.2310 2311insgcaccgtgg
- Nm 005228.3:c.2310 2311insggc
- Nm 005228.3:c.2310 2311insggggac
- Nm 005228.3:c.2310 2311insgggtta
- Nm 005228.3:c.2310 2311insggt
- Nm 005228.3:c.2311 2312insgcgtggaca
- Nm 005228.3:c.2311 2312instggccaccccca
- Nm 005228.3:c.2313 2314insaac
- Nm 005228.3:c.2315 2316insgacacaccc
- Nm 005228.3:c.2318 2319insccccca
- Nm 005228.3:c.2319 2320insaacccccac
- Nm 005228.3:c.2319 2320inscac
- Nm 005228.3:c.2319 2320insccccac
- Nm 005228.3:c.2320 2321insgcaacccccacg
- Nm 005228.3:c.2321 2322insccacgt
- Nm 005228.3:c.2322 2323inscacgtg
- Nm 005228.3:c.2374c t
- Nm 005228.3:c.2375t a
- Nm 005228.3:c.2386g a
- Nm 005228.3:c.2386g c
- Nm 005228.3:c.2389t a
- Nm 005228.3:c.2390g c
- Nm 005228.3:c.2572 2573delctinsaa
- Nm 005228.3:c.2572 2573delctinsag
- Nm 005228.3:c.2573 2574deltginsgt
- Nm 005228.3:c.323g a
- Nm 005228.3:c.787a c
- Nm 005228.3:c.865g a
- Nm 005228.3:c.866c a
- Nm 005228.3:c.866c t
- Nm 005228.3:c.Delginsccacgtg
- Nm 005228.3:c2310 2311insggcaca
- Nm 005228.4(egfr):c.2315 2320dupcccacg
- Nm 005228.5:c.2125g a
- Nm 005228.5:c.2305g t
- Nm 005228.5:c.2497t g
- Nm 005228.5:c.2500g c
- Nm 005228.5:c.2500g t
- Nm 005228.5:c.2504a t
- Nm 005228.5:c.2527g a
- Nm 005896.3:c.356g a
- Nm 005896.3:c.394 395delcginsgt
- Nm 005896.3:c.394 395delcginstc
- Nm 005896.3:c.394c a
- Nm 005896.3:c.394c g
- Nm 005896.3:c.394c t
- Nm 005896.3:c.395 396delgtinsac
- Nm 005896.3:c.395g a
- Nm 005896.3:c.395g t
- Nm 007294.3:c.68 69delag
- Nm 007294.3c.5266dupc
- Nm 022552.4:c.2711c t
- Nm 024529.4:c.1a g
- Nm 177438.2:c.5438a g
- Nm/pcb/pred/vbl/vcr
- Nm/pcb/pred/vbl
- Nm/pcb/pred/vcr
- Nma
- Nmd transcript variant
- Nmdmc
- Nmf
- Nmh
- Nmo
- Nmol/l/(kg/m2)
- Nmol/l/mg
- Nmol/l/ug
- Nmol/mgprotein
- Nmol/ml/min
- Nmol/umol/l
- Nmolbce/l
- Nmolbce/mmol
- Nmolbce/nmol
- Nmolh/mg/ml
- Nmolh/umol/l
- Nmor
- Nmosd
- Nmt2
- Nmva
- Nmyc and stat interactor
- Nnal-glucuronide
- Nnif
- Nnk
- Nnmt
- No abdominal bruits
- No analgesic
- No anterior movement
- No audible alarm
- No audible prompt/feedback
- No bake coconut cashew bars
- No bed partner or room mate
- No cardiac valve regurgitation
- No cardiac valve stenosis
- No cases
- No change in weight
- No cleavage enzyme used
- No complication
- No cytogenetic response
- No decrease in food intake
- No device output
- No device problem found
- No diarrhea, rectal discomfort, or constipation
- No difference
- No difficulty
- No disease
- No display/image
- No distension with total obstruction of flow
- No dysplasia
- No ecg waveforms present
- No energy at all
- No erections at all
- No errors
- No evidence of disease
- No evidence of leukemia
- No evidence of metastatic disease
- No exertion at all
- No fail safe mechanism
- No fatigue or lack of energy past 30 days
- No fatigue
- No findings available
- No flow
- No health consequences or impact
- No higher limit of normal
- No intent to compound 506e (drug shortage) drugs
- No inversion
- No involvement
- No labial escape
- No longer clinically benefiting
- No longer marketed
- No lower limit of normal
- No man's land
- No mbo, but issues with constipation
- No measurable disease
- No metastasis
- No more
- No mutation detected
- No necrosis
- No one to help
- No opinion
- No or minimal exposure to secondhand smoke
- No pacing
- No pain and no disturbing body sensations
- No partner past 30 days
- No pathologic evidence of distant metastasis
- No patient involvement
- No pattern
- No pressure
- No problem detected
- No protein cleavage reagent used
- No psychological problems
- No rank
- No rearrangement detected
- No reconstruction
- No response/stable disease
- No response/stable response
- No restrictions
- No sexual activity
- No sexual drive or interest
- No shortness of breath
- No smoke exposure
- No srce
- No steady place to sleep at night
- No superior movement of thyroid cartilage
- No urinary control whatsoever
- No urinary frequency or urgency
- No visible initiation at any location
- No visible posterior motion of tb
- No weight loss
- No, I don't want help
- No, I want the help but can't get it
- No, not limited at all
- No-Brainer
- No-See-Um
- No-tillage
- No
- Noblesse
- Nocardia
- Nocardial infection
- Nocardiosis
- Nocent
- Nociception
- Nociceptive pain
- Nociceptive
- Nocifensor
- Nocturia
- Nocturnal activity
- Nocturnal
- Nodal growth differentiation factor gene
- Nodal growth differentiation factor
- Nodal involvement
- Nodal marginal zone lymphoma by ann arbor stage
- Nodal mass
- Nodal station
- Nodal, mouse, homolog of gene
- Nodal
- Node negative
- Node of bizzozero
- Node stage n1a
- Node stage n1b
- Node stage n1c
- Node stage n2a
- Node stage n2b
- Node stage n2c
- Node stage n3a
- Node stage n3b
- Node stage n3c
- Node
- Nodes
- Nodosa
- Nodosum
- Nodular and massive retinal gliosis
- Nodular basal cell carcinoma of the skin
- Nodular lesion
- Nodular partial response
- Nodular sclerosis hodgkin lymphoma, cellular phase
- Nodular sclerosis hodgkin's lymphoma
- Nodular tumor
- Nodular
- Nodule consistency
- Nodule margin conspicuity
- Nodule shape
- Nodule
- Nodules
- Nodulocystic
- Nodulus
- Noel (no observable effect level)
- Nogai
- Nogc, alpha 1 subunit gene
- Nogc, beta 1 subunit gene
- Noise artifact
- Noise, audible
- Noises
- Noisy image
- Noload loss
- Nomenklatura
- Nomina
- Nominal (inflation) pressure
- Nominal diameter
- Nomogenesis
- Nomotopic
- Non a4 component of amyloid precursor
- Non academic hospital
- Non acute inpatient care
- Non adjuvanted a(h1n1) influenza vaccine
- Non aerosol spray dose form
- Non anemic iron deficiency
- Non biological
- Non brca gene variant
- Non cancer diagnosis
- Non carious
- Non citizen national
- Non clinical nanoparticle application
- Non clinical specialty nurse
- Non clonal
- Non commercial sources
- Non communicable disorder
- Non compartmental analysis
- Non compliance with non study device
- Non compliance with study device
- Non compliance with study drug
- Non compliance with study schedule
- Non compliant adam dataset
- Non congenital amegakaryocytosis
- Non convulsive status epilepticus
- Non covid 19 related co morbidity
- Non cr/non pd non cr/non pd
- Non ctc
- Non diagnostic q waves
- Non diagnostic quality
- Non disclosure agreement
- Non encapsulated neoplasm
- Non enzyme inducing aed
- Non esterified fatty acid, free
- Non esterified fatty acid, saturated
- Non esterified fatty acid, unsaturated
- Non fasting biospecimen
- Non focal metastasis
- Non fucosylated umbilical cord blood tregs
- Non functional brca mutation
- Non functional defect
- Non gc/abc dlbcl
- Non health care professional
- Non hematopoietic stem cell research
- Non hemolyzed
- Non hereditary lesion
- Non hereditary
- Non hodgkin lymphoma by ann arbor stage
- Non hodgkin lymphoma during pregnancy
- Non hodgkin lymphoma in remission
- Non hodgkin lymphoma
- Non hodgkin lymphomas
- Non hodgkin's lymphoma of the nasal cavity
- Non hodgkin
- Non homologous end joining
- Non household environment
- Non human clinical subject data section
- Non human gene
- Non human papillomavirus related pein
- Non human protein
- Non human source plasma
- Non idmc cmte doc
- Non igm mgus
- Non inbred obese stock atp7a^mo to (tortoise) mutn
- Non index lesion
- Non infective inflammatory bowel disease
- Non insulin hypoglycemic
- Non intestinal type
- Non invasive cardiac stress test
- Non invasive cribriform carcinoma
- Non invasive cribriform ductal breast carcinoma
- Non invasive detection
- Non invasive lesion
- Non invasive papillary transitional cell carcinoma
- Non investigational product documentation
- Non investigational product supply plan
- Non ischemic stroke
- Non keratinizing malignant squamous cell
- Non linear parameter identification
- Non malignant neoplasm
- Non malignant nodule
- Non mammalian organisms as models for cancer
- Non measurable
- Non medical object or device
- Non melanoma related
- Non melanomatous lesion
- Non metastatic brain neoplasm
- Non metastatic breast carcinoma
- Non metastatic cerebral neoplasm
- Non metastatic childhood rhabdomyosarcoma
- Non metastatic esophageal carcinoma
- Non metastatic extraskeletal ewing's sarcoma
- Non metastatic extraskeletal osteogenic sarcoma
- Non metastatic head and neck carcinoma
- Non metastatic lung carcinoma
- Non metastatic malignant brain neoplasm
- Non metastatic malignant hemangiopericytoma
- Non metastatic neoplasm
- Non metastatic prostate carcinoma
- Non mucoid
- Non muscle invasive bladder urothelial carcinoma
- Non necrotizing
- Non neoplastic appendix disorder
- Non neoplastic bone disorder
- Non neoplastic chest wall disorder
- Non neoplastic conjunctival disorder
- Non neoplastic connective tissue
- Non neoplastic corneal disorder
- Non neoplastic disorder, nos
- Non neoplastic disorder
- Non neoplastic endocrine pancreas disorder
- Non neoplastic eye disease
- Non neoplastic eyelid disorder
- Non neoplastic genitourinary system disorder
- Non neoplastic gingival disorder
- Non neoplastic lacrimal apparatus disorder
- Non neoplastic lip disorder
- Non neoplastic middle ear disorder
- Non neoplastic muscle disorder
- Non neoplastic musculoskeletal system disorder
- Non neoplastic optic nerve disorder
- Non neoplastic oral disease
- Non neoplastic retinal disorder
- Non neoplastic skin cyst
- Non neoplastic soft tissue disorder
- Non neoplastic sternal disorder
- Non neoplastic stomach disorder
- Non neoplastic tongue disorder
- Non neoplastic tonsillar disorder
- Non neoplastic trigeminal nerve disorder
- Non neoplastic ureter disorder
- Non neoplastic urethra disease
- Non neoplastic uveal disorder
- Non neoplastic vascular disorder
- Non neoplastic, non molar trophoblastic disorder
- Non nucleic acid
- Non pou domain containing, octamer binding gene
- Non prostatic acid phosphatase
- Non protein coding rna 21 gene
- Non protein coding rna 8
- Non protocol therapy table
- Non protocol
- Non q wave myocardial infarction by ekg finding
- Non radiological progression
- Non rebreather facemask
- Non recurrent esophageal carcinoma
- Non recurrent lung carcinoma
- Non reproducible results
- Non research project
- Non response
- Non rhabdomyosarcoma soft tissue sarcoma
- Non rodent model
- Non severe aplastic anemia
- Non small
- Non smoked tobacco only
- Non solid ground glass pulmonary nodule
- Non specific ekg/ecg changes
- Non specific st t changes
- Non squam epi cells
- Non squamous non small cell lung carcinoma
- Non statin dyslipidemics
- Non steroidal estrogen
- Non stop decay
- Non study equipment malfunction
- Non susceptible
- Non sustained atrial tachycardia by ekg finding
- Non sustained vt
- Non synonymous c kit gene mutation
- Non synonymous janus kinase family gene mutation
- Non t non b acute lymphoblastic leukemia
- Non target enhancing response
- Non target extra nodal
- Non target nodal
- Non target non enhancing response
- Non traumatic extradural hemorrhage
- Non traumatic hemoperitoneum
- Non trunk
- Non tumor cell derivative vaccine
- Non tumor tissue area
- Non uniform signal intensity artifact
- Non union bone fracture
- Non us citizen
- Non v600 braf mutation
- Non vascularized autograft
- Non vegfr tk inhibitor
- Non viral vector gene complex
- Non visceral
- Non voltage dependent calcium channel
- Non word repetition
- Non-acute inpatient care
- Non-anemic iron deficiency
- Non-articulated
- Non-bacterial osteomyelitis
- Non-biologic dmard
- Non-brca gene variant
- Non-cellular tissue component
- Non-cesarean uterine surgical scar
- Non-classic clah (fgd variant)
- Non-clonal
- Non-compartmental analysis
- Non-compliance with non-study device
- Non-compliance with study device
- Non-compliance with study schedule
- Non-compliant adam dataset
- Non-confirmatory result
- Non-contact specular microscopy
- Non-covid-19 related co-morbidity
- Non-cytotoxic drug therapy
- Non-diagnostic q waves
- Non-diarrhea-associated hemolytic uremic syndrome
- Non-disclosure agreement
- Non-discrimination
- Non-enzyme inducing aed
- Non-erosive arthritis
- Non-erythroid ankyrin
- Non-focal metastasis
- Non-fucosylated umbilical cord blood tregs
- Non-functional brca mutation
- Non-hair bearing lip
- Non-hdl cholesterol/hdl cholesterol
- Non-health care professional
- Non-hemolyzed
- Non-high density lipoprotein
- Non-homologous end joining (NHEJ) noncoding strand
- Non-household environment
- Non-human papillomavirus-related pein
- Non-icr/non-iupd
- Non-idmc cmte doc
- Non-igm mgus
- Non-interpretable
- Non-invasive detection
- Non-invasive diagnostic evidence of heart failure
- Non-invasive imaging change
- Non-investigational product documentation
- Non-investigational product supply plan
- Non-keratinizing squamous cell carcinoma
- Non-measurable
- Non-mll mllt10 rearrangement positive
- Non-moribund sacrifice
- Non-msi-h/dmmr
- Non-muscle filamin
- Non-native antigen receptor
- Non-neoplastic disorder, miscellaneous
- Non-neoplastic disorder
- Non-neoplastic findings
- Non-neoplastic lacrimal apparatus disorder
- Non-neoplastic musculoskeletal system disorder
- Non-organic ftt
- Non-pathological
- Non-pd
- Non-probability sample
- Non-prostatic acid phosphatase
- Non-protein coding rna 12 gene
- Non-protocol therapy table
- Non-quantifiable mrd positivity
- Non-rebreather facemask
- Non-regional lymph nodes/ distant lymph nodes
- Non-rhabdomyosarcoma soft tissue sarcoma
- Non-solid ground-glass pulmonary nodule
- Non-squamous epithelial cells
- Non-squamous non-small cell lung carcinoma
- Non-study equipment malfunction
- Non-sustained atrial tachycardia by ekg finding
- Non-syndromic familial thyroid cancer
- Non-synonymous c-kit gene mutation
- Non-synonymous cd246 gene mutation
- Non-synonymous janus kinase family gene mutation
- Non-synonymous sel10 gene mutation
- Non-t non-b acute lymphoblastic leukemia
- Non-target enhancing response
- Non-target enhancing
- Non-target extra nodal
- Non-target nodal
- Non-target non-enhancing response
- Non-target non-enhancing
- Non-v600 activating braf mutation
- Non-v600 braf mutation
- Non-vascular plants
- Non-vegfr tk inhibitor
- Non-wnt/non-shh activated
- NonAlcoholic
- Non
- Nonabsorbent
- Nonacquisitionmodalitiesinstudycode
- Nonaddict
- Nonadherence in children
- Nonadherence
- Nonalcoholic steatohepatitis (nash)
- Nonalcoholic steatohepatitis nash
- Nonalcoholic
- Nonallergic rhinitis
- Nonallergic
- Nonambulatory
- Nonarticular
- Nonassociative
- Nonatheromatous arteriosclerosis
- Nonatheromatous
- Nonatopic
- Noncalcified
- Noncancerous bone tumors
- Noncancerous ovarian growths
- Noncancerous skin growths
- Noncancerous
- Noncarbohydrate
- Noncarcinogenic
- Noncardiac surgical history
- Noncaseating
- Noncatalytic region of tyrosine kinase, beta gene
- Noncholera vibrio infections
- Noncholera
- Nonchronically sun exposed site
- Noncitizen
- Nonclinical study sponsor
- Nonclinical written and tabulated summaries
- Noncommissioned
- Noncommunicable
- Nonconducted p wave physiology not defined
- Nonconforming
- Noncontagious
- Noncontractile
- Nonconvulsive
- Noncoronary
- Noncytotoxic
- Nondiagnostic
- Nondisposable
- Nondisseminated
- Nondrinker
- Nondrowsy
- Nondrying
- None (no use of medication)
- None allergy
- None at all
- None beyond physiologic replacement dose
- None identified
- None of the above
- None or one activity required help
- None to modest pain
- None/recurrence
- None
- Noneffervescent
- Nonenumerated
- Nonerosive gastritis
- Nonerosive
- Nonesuch
- Nonexchangeable site
- Nonfebrile
- Nonflagellated
- Nonfreezing tissue injuries
- Nonfreezing
- Nonfunctional adrenal masses
- Nonfunctional
- Nonfunctioning adrenal cortex adenoma
- Nonfunctioning pituitary gland macroadenoma
- Nonfunctioning pituitary gland microadenoma
- Nongerminomatous germ cell tumor of the cns
- Nonglandular
- Nongonococcal
- Nongranular
- Nongravid
- Nonhealing
- Nonhematic cells/leukocytes
- Nonhematic cells
- Nonhemorrhagic
- Nonheritable
- Nonhistone chromosomal protein hmg2 gene
- Nonhomologous end joining factor 1gene
- Nonhostindicator
- Nonindustrial private forests
- Noninfectious meningitis
- Noninfectious
- Noninfective endocarditis
- Noninfective
- Noninvasive pancreatic mucinous cystic neoplasm
- Nonischemic
- Nonkeratinized
- Nonkeratinizing dysplasia
- Nonketotic
- Nonlymphocytic
- Nonlymphoid
- Nonlysosomal ceramidase c
- Nonmammalian embryo
- Nonmass like enhancement
- Nonmass-like enhancement
- Nonmedullated
- Nonmelanoma
- Nonmembranous cytoplasmic organelle
- Nonmetastatic gestational trophoblastic tumor
- Nonmetastatic
- Nonmuscle myosin heavy chain ii a
- Nonmyeloablative stem cell transplantation
- Nonmyeloid
- Nonnarcotic
- Nonneoplastic
- Nonnervous
- Nonneuronal
- Nonobese
- Nonobstructive
- Nonocclusive
- Nonolfactory
- Nonopaque
- Nonossifying fibromyxoma
- Nonparametric regression method
- Nonparametric test
- Nonpaternity
- Nonphotosensitive
- Nonpolyposis
- Nonprofit corporations
- Nonpulsatile
- Nonreasoncode
- Nonreduction
- Nonrenal cl norm by bmi
- Nonrenal cl norm by dose
- Nonrenal cl norm by sa
- Nonrenal cl norm by wt
- Nonrenal cl
- Nonrenal
- Nonrenewable
- Nonreplicating
- Nonrequirements consumer
- Nonresponse therapy type
- Nonrheumatoid
- Nonrhythmic
- Nonribosomal peptides
- Nonrotatory
- Nonsedating
- Nonsedative
- Nonsense mediated mrna decay
- Nonsmall cell adenocarcinoma
- Nonspecific interstitial pneumonia
- Nonspecific murmur
- Nonspecific symptoms
- Nonspecific
- Nonspore forming
- Nonspore
- Nonstandard device
- Nonsteroidal estrogens
- Nonstress
- Nonstriated
- Nonsugar
- Nonsuicidal self injury nssi
- Nonsuicidal self injury
- Nonsuicidal
- Nonsuppurative
- Nonsustained supraventricular tachycardia
- Nonsyndromic pancreatic endocrine tumor
- Nonsynonymous mutation
- Nontariff trade barriers
- Nontaster
- Nonthrombocytopenic
- Nonthrombotic pulmonary embolism
- Nonthrombotic
- Nontoxic
- Nontraumatic
- Nontuberculous mycobacterial infections
- Nontuberculous
- Nontyphoidal salmonella infections
- Nontyphoidal
- Noonan syndrome
- Noonan's Syndrome
- Noonan
- Nop10 ribonucleoprotein gene
- Nop53 ribosome biogenesis factor gene
- Nopho
- Nora's lesion
- Norelgestromin
- Norepexr
- Norepinephrine receptor
- Norepinephrine secreting
- Norepinephrine secretion induction
- Norethynodrel
- Norfloxacin
- Norgestimate
- Norgestrel
- Norleucine
- Norlignans
- Norm by bmi
- Norm by dose
- Norm by sa
- Norm by wt
- Normal Weight
- Normal amount of sexual drive and interest for you
- Normal appearance of the extremities
- Normal blood test result
- Normal bone marrow test result
- Normal breast like subtype of breast cancer
- Normal capillary refill
- Normal carotid arteriogram
- Normal cells/total cells
- Normal cerebral arteriogram
- Normal coronary arteriogram
- Normal crossreacting antigen positive
- Normal crossreacting antigen
- Normal lab test result
- Normal labor and delivery
- Normal laboratory values
- Normal load
- Normal or reference range description
- Normal pregnancy
- Normal pressure hydrocephalus
- Normal range for character results
- Normal range indicator
- Normal range lower limit for standardized result
- Normal range upper limit for standardized result
- Normal renal arteriogram
- Normal saturation
- Normal situs
- Normal thoracic appearance
- Normal tissue segment
- Normal urine test result
- Normal, average (2-2.9 mph)
- Normal
- Normality
- Normalized time
- Norman Thomas
- Normbaso
- Normdp
- Normeexr
- Normergic
- Normergy
- Normetanephrine secreting
- Normetanephrine
- Normoactive
- Normoblast
- Normoblastic erythroid hyperplasia
- Normoblasts/total cells
- Normocalcemia
- Normochromia
- Normochromic
- Normocyte
- Normocytic
- Normoglycemia
- Normokalemic
- Normokpp
- Normotension
- Normotonic
- Normovolemia
- Norovirus genogroup I and/or genogroup ii rna
- Norovirus genogroup ii.4 iga antibody
- Norovirus genogroup ii.4 igg antibody
- Norovirus genogroup ii.4 igm antibody
- Norplant
- Norrie
- Norseman
- Norspermine
- Nortestrionate
- North Platte
- North african
- North caspian language
- North central states
- North korean
- North mbundu
- North mid atlantic states
- North ndebele
- North star
- North-central
- North
- Northampton
- Northbound
- Northeast Region
- Northeastern asian descent
- Northern europe
- Northern frisian
- Northern midwest states
- Northern
- Nortriptyline/en
- Norvaline
- Norwalk calicivirus
- Norwalk-like virus
- Norway maple
- Norwegian bokmal
- Norwood
- Nose and paranasal sinus disorders
- Nose and sinus disorders
- Nose and sinuses
- Nose disorders
- Nose swab
- Nose
- Nosebleeds
- Nosed
- Nosema
- Nosher
- Nosogeography
- Nosography
- Nosologist
- Nosophobia
- Nosopsyllus
- Not a combination product
- Not above shoulder
- Not above waist
- Not acting self
- Not alert
- Not allowed to collect
- Not applicable - never quit
- Not applicable - not currently working
- Not as good
- Not asked
- Not assigned
- Not associated with abnormality
- Not associated with disease
- Not at all bothered
- Not at all comfortable
- Not at all good
- Not at all helpful
- Not at all important
- Not at all satisfied
- Not at all short of breath
- Not at all sure
- Not at all tired
- Not being able to stop or control worrying
- Not bothered at all
- Not cancer related
- Not classified
- Not compounding from bulk ingredient
- Not compounding sterile products
- Not controlled by medication
- Not defined
- Not determined
- Not difficult at all
- Not disrupted at all
- Not done, left
- Not done, right
- Not during the past month
- Not eligible
- Not enough to make ends meet
- Not erupted tooth
- Not evaluated: not provided or available
- Not evaluated
- Not firm enough for any sexual activity
- Not for profit organization
- Not fused
- Not identified
- Not independent
- Not known if testing was performed
- Not known
- Not less than
- Not limited at all
- Not made with natural rubber latex
- Not measured
- Not meeting criteria
- Not more than
- Not obtained
- Not often
- Not otherwise specified genetic subtypes
- Not provided or available
- Not quite so much now
- Not responsive
- Not returned
- Not solved
- Not true at all
- Not very much
- Not very sure
- Not-evaluated: not provided or available
- Not-for-profit
- Not
- Notary
- Notatum ige ab rast score
- Notatum igg ab rast score
- Notch 1 gene
- Notch 2 gene
- Notch 3 gene
- Notch 3 staining method
- Notch 4 gene
- Notch homolog 3 gene mutation
- Notch homolog 4 gene mutation
- Notch intracellular domain
- Notch like egf repeat containing gene
- Notch receptor gene family mutation
- Notch receptors
- Notch, drosophila, homolog of, 3 gene
- Notch1 activating mutation
- Notch2 activating mutation
- Notch3 activating mutation
- Notch4 activating mutation
- Notched (concavity)
- Note to file master list
- Note
- Nothing made me happy
- Nothings
- Nothosaur
- Notice throat discomfort;throat discomfort
- Notification of discontinuation of clinical trial
- Notification of regulatory identification number
- Notificationreceiver
- Notified body (nb)
- Notoedres
- Notoedric
- Notonectidae
- Nottingham grade
- Nov gene
- Nova Scotia salmon
- Nova family gene
- Nova family
- Novantrone/fluorouracil/leucovorin
- Novantrone/oncovin/vinblastine/prednisone
- Novasure endometrial ablation
- Novasure
- Novel apoptosis related
- Novel foods
- Novel interleukin receptor
- Novel neurotrophin 1
- Novel reductase 1
- Novelisation
- Novembichin
- Novial
- Novidium chloride
- Novottf 100l system
- Novottf-100l system
- Novottf-200a system
- Nowise
- Nowruz
- Noxa
- Nozin
- Np 000032.1:p.Cys130arg,arg176arg
- Np 000050.2:p.Ser1982argfs
- Np 000101.2:p.Ile543val
- Np 000121.2:p.Arg534gln
- Np 000132.3:p.Pro253arg
- Np 000132.3:p.Ser252trp
- Np 000242.1:p.Ala636pro
- Np 000507.1:p.Q125r
- Np 000507.1:p.Q227e
- Np 000507.1:p.Q227l
- Np 000507.1:p.Q227p
- Np 000507.1:p.Q227r
- Np 000507.1:p.R160c
- Np 000507.1:p.R201c
- Np 000507.1:p.R201h
- Np 000507.1:p.R201s
- Np 000509.1:p.Glu122lys
- Np 000509.1:p.Glu7lys
- Np 000509.1:p.Glu7val
- Np 001020329.1:p.Pro98ser
- Np 001091679.1:p.Thr41ala
- Np 001138385.1:p.Cys383arg
- Np 001138385.1:p.Lys660glu
- Np 001138385.1:p.N550h
- Np 001138385.1:p.N550k
- Np 001138385.1:p.Ser373cys
- Np 001138385.1:p.Y376c
- Np 001138388.1:p.Val564phe
- Np 001280119.1:p.Q338h
- Np 001895.1:p.Ser37phe
- Np 001895.1:p.Ser45phe
- Np 001895.1:p.Ser45pro
- Np 002098.1 :p.Lys28met
- Np 002159.2:p.R140g
- Np 002159.2:p.R140l
- Np 002159.2:p.R140q
- Np 002159.2:p.R140w
- Np 002159.2:p.R140x
- Np 002159.2:p.R172s
- Np 002159.2:p.R172w
- Np 002159.2:p.R172x
- Np 002459.2:p.Leu265pro
- Np 003528.1:p.Lys28met
- Np 004039.1:p.Met1arg
- Np 004295.2:p.Gly1128ala
- Np 004295.2:p.Gly159fs
- Np 004295.2:p.Ile1170asn
- Np 004295.2:p.Ile1170ser
- Np 004295.2:p.Ile1171asn
- Np 004295.2:p.Leu1196met
- Np 004295.2:p.Lys1062met
- Np 004295.2:p.Met1166arg
- Np 004295.2:p.Phe1174cys
- Np 004295.2:p.Phe1174leu
- Np 004295.2:p.Phe1174val
- Np 004295.2:p.Phe1174xxx
- Np 004295.2:p.Phe1245ile
- Np 004295.2:p.Phe1245leu
- Np 004295.2:p.Phe1245xxx
- Np 004295.2:p.R1192p
- Np 004295.2:p.R1275q
- Np 004295.2:p.R1275x
- Np 004295.2:p.Thr1087ile
- Np 004295.2:p.Y1278s
- Np 004955.2:p.Y303h
- Np 005887.2:p.R119q
- Np 005887.2:p.R132c
- Np 005887.2:p.R132g
- Np 005887.2:p.R132h negative
- Np 005887.2:p.R132h
- Np 005887.2:p.R132l
- Np 005887.2:p.R132s
- Np 005887.2:p.R132v
- Np 005887.2:p.R132x
- Np 006051.1:p.N159y
- Np 009225.1:p.Glu23valfs
- Np 009225.1:p.Q1756pfs
- Np 072046.2:p.Pro904leu
- Np 109587.1:p.Pro128leu
- Np 758519.1:p.Gly751ala
- Np 803187.1:p.Glu1813asp
- Np 803187.1:p.Y1225x
- Npb no palliative benefit
- Npb-no palliative benefit
- Npbaf complex
- Npc 1c
- Npc1 like 1 gene
- Npcr
- Npd
- Npepps
- Npi questionnaire question
- Npi1a
- Npi1afs
- Npi1b
- Npi1bfs
- Npi1c
- Npi1cfs
- Npi1d
- Npi1dfs
- Npi1dist
- Npi1e
- Npi1efs
- Npi1f
- Npi1ffs
- Npi1g
- Npi1gfs
- Npi1h
- Npi1hfs
- Npi1i
- Npi1ifs
- Npi1j
- Npi1jfs
- Npi1k
- Npi1kfs
- Npi1l
- Npi1lfs
- Npi1tot
- Npkc delta
- Npkc epsilon
- Npkc iota
- Npkc mu
- Npkc nu
- Npkc-delta
- Npkc-epsilon
- Npkc-iota
- Npm1 alk fusion gene
- Npm1-rara long fusion gene
- Npm1-rara short fusion gene
- Npmc+ aml
- Npmc
- Npmw-peptide vaccine
- Npo
- Nppb gene product
- Nprap
- Nprpsa antibody
- Nps questionnaire question
- Nps0108a
- Nps0108b
- Nps0108c
- Nps0108d
- Nps0110a
- Nps0110b
- Npt timing
- Npt type
- Npy1-r
- Nqo
- Nr lu 10 antigen
- Nr-no response
- Nr2a
- Nr3a1 gene mutation
- Nr3a1 status by immunohistochemistry
- Nr3a2 status by immunohistochemistry
- Nr3c4 staining method
- Nr4a3/ewsr1 fusion gene
- Nrage
- Nrarp
- Nras mutational analysis performed
- Nras mutational analysis testing method
- Nrdr
- Nrpntacc
- Nrsa individual postdoctoral fellowships (f32)
- Nrsa
- Nsaa clinical classification question
- Nsaa111a
- Nsaa117a
- Nsar
- Nsc number property
- Nsclc with egfr thr790met mutation
- Nsclc-specific mils
- Nsd1 nup98 fusion gene
- Nsd1 nup98 fusion protein
- Nse positive neoplastic cells present
- Nsf attachment protein alpha gene
- Nsmaf
- Nsmase
- Nssi
- Nt5e
- Nta agarose
- Ntai
- Ntau-methylhistidine
- Ntds
- Ntelocrt
- Ntelop
- Nth like dna glycosylase 1 gene
- Ntind
- Ntlwind
- Ntms
- Ntrk1 tpm3 fusion gene
- Ntrk3/etv6 fusion gene
- Nu/cl
- Nu/nu
- Nuance
- Nuc agent ionizing radiation type
- Nuc agent irradiation source beam strength
- Nuc agent mixed field indicator
- Nuc agent radioisotope species name
- Nuc agent source
- Nuc challenge agent
- Nuc targeted injury
- Nuchal cord
- Nuchal lymph node
- Nuchal
- Nucle/us (in cell biology)
- Nuclear assembly factor 1 ribonucleoprotein gene
- Nuclear body protein gene
- Nuclear division alteration
- Nuclear enlargement
- Nuclear expression intact
- Nuclear extract
- Nuclear factor (erythroid derived 2) like 2 gene
- Nuclear factor (erythroid derived 2), 45kda gene
- Nuclear factor I/a gene
- Nuclear factor I/a wt allele
- Nuclear factor I/b gene
- Nuclear factor I/b wt allele
- Nuclear factor from high endothelial venules
- Nuclear factor kappa b subunit 2 gene
- Nuclear factor nfkappab inhibitor kinase
- Nuclear factor of activated t-cells 45 kda
- Nuclear factor of activated t-cells
- Nuclear factor, erythroid 2 like 2 gene mutation
- Nuclear factor, interleukin 3 regulated gene
- Nuclear factor, interleukin 3 regulated wt allele
- Nuclear gastrointestinal scans
- Nuclear gene
- Nuclear grade iii or iv
- Nuclear hormone receptors
- Nuclear inclusions
- Nuclear localization signals
- Nuclear matrix protein-22 assay
- Nuclear matrix protein
- Nuclear medicine subcategory
- Nuclear mitogen
- Nuclear mitotic apparatus protein 1 gene
- Nuclear mitotic apparatus protein 1 wt allele
- Nuclear pleomorphism present
- Nuclear protein in testis fusion gene positive
- Nuclear protein in testis gene rearrangement
- Nuclear protein in testis gene translocation
- Nuclear protein in testis gene
- Nuclear protein in testis midline carcinoma
- Nuclear protein in testis positive
- Nuclear receptor binding factor 1 gene
- Nuclear receptor binding protein 1 gene
- Nuclear receptor binding protein 1 wt allele
- Nuclear receptor binding protein
- Nuclear receptor binding set domain protein 1 gene
- Nuclear receptor co repressor 1 gene
- Nuclear receptor co repressor 2 gene
- Nuclear receptor coactivator 1 gene
- Nuclear receptor coactivator 2 gene
- Nuclear receptor coactivator 3 gene
- Nuclear receptor coactivator 4 gene
- Nuclear receptor coactivator 5 gene
- Nuclear receptor coactivator 5 wt allele
- Nuclear receptor coactivator 6 gene
- Nuclear receptor coactivator gene
- Nuclear receptor gene
- Nuclear receptor interacting protein 1 gene
- Nuclear receptor interacting protein 3 gene
- Nuclear receptor interacting protein 3 wt allele
- Nuclear receptor subfamily 1 group I member 2 gene
- Nuclear receptor subfamily 1 group a
- Nuclear receptor subfamily 1 group h member 3 gene
- Nuclear receptor subfamily 1 group h
- Nuclear receptor subfamily 3 group a
- Nuclear scan
- Nuclear scans of the digestive tract
- Nuclear staining
- Nuclear swelling
- Nuclear transcription factor nf kb
- Nuclear transcription factor nf-kb
- Nuclear transcription factor y, alpha gene
- Nuclear transcription factor y, alpha wt allele
- Nuclear translocation
- Nuclear
- Nuclease protection assay
- Nucleated blood cell
- Nucleated red blood cells present
- Nucleated red cells
- Nucleation
- Nuclei of various sizes and shapes present
- Nuclei, structure/function
- Nucleic Acid
- Nucleic acid aliquot unique identifier
- Nucleic acid binding
- Nucleic acid biochemistry, dna
- Nucleic acid biochemistry, enzymology
- Nucleic acid biochemistry, rna - ribonucleic acid
- Nucleic acid biochemistry, rna
- Nucleic acid biochemistry, synthesis
- Nucleic acid biochemistry
- Nucleic acid bond constituents
- Nucleic acid bond
- Nucleic acid cleavage
- Nucleic acid concentration
- Nucleic acid core facility
- Nucleic acid detection reagent
- Nucleic acid extraction reagent
- Nucleic acid folding
- Nucleic acid for in vitro diagnostic device
- Nucleic acid synthesis alteration
- Nucleic acid synthesis
- Nucleic acid testing
- Nucleic acid type
- Nucleic acid volume
- Nucleic acid
- Nucleic rna
- Nucleic
- Nucleicacidphysicallocation
- Nucleicacidsequencefeature
- Nucleocapsid protein
- Nucleocytoplasmic interaction
- Nucleocytoplasmic shuttling
- Nucleocytoplasmic transport
- Nucleocytoplasmic
- Nucleohistone
- Nucleolar and spindle associated protein 1 gene
- Nucleolar associated chromatin
- Nucleolar protein ankt
- Nucleolar protein family a, member 2 gene mutation
- Nucleolar protein family a, member 2 gene
- Nucleolar protein family a, member 3 gene mutation
- Nucleolar protein family a, member 3 gene
- Nucleolar
- Nucleolin gene
- Nucleolin wt allele
- Nucleolonema
- Nucleophosmin gene mutation
- Nucleoporin 107kda gene
- Nucleoporin 107kda wt allele
- Nucleoporin 214kda gene
- Nucleoporin 93 gene
- Nucleoporin 98 gene mutation
- Nucleoporin 98 gene rearrangement
- Nucleoporin 98 gene
- Nucleoporin gene
- Nucleoporin, 93-kd gene
- Nucleoporin, 98 kd gene
- Nucleoporins
- Nucleoprotamine
- Nucleosidase
- Nucleoside diphosphate kinase a gene
- Nucleoside-triphosphate phosphatase
- Nucleosomal linker
- Nucleosomal repeat length
- Nucleosome occupancy and methylome sequencing
- Nucleosome remodeling factor, large subunit
- Nucleosome remodeling factor
- Nucleotidase deficiency
- Nucleotidase protein variant
- Nucleotide / nucleic acid chemistry
- Nucleotide analog chemotherapy
- Nucleotide aptamers
- Nucleotide connection points
- Nucleotide excision repair inhibition
- Nucleotide metabolism alteration
- Nucleotide motifs
- Nucleotide substitution site
- Nucleotide synthesis alteration
- Nucleotide
- Nucleotidyltransferase
- Nucleotoxic
- Nucletron oncentra
- Nucleus lenticularis
- Nucleus of diagonal band
- Nucleus
- Nude mouse assay
- Nude
- Nuel
- Nuf2, ndc80 kinetochore complex component gene
- Nuf2r
- Null mouse
- Null
- Nulligravida
- Nullipara
- Nulliparity
- Nullisomic
- Nullisomics
- Nullizygous
- Num fraction
- Num metaphases
- Num nuc markers exhibit instability
- Numatrin
- Numb homolog (drosophila) gene
- Number cancellation: correct
- Number cancellation: errors
- Number cancellation: remind
- Number cancellation
- Number full term live births
- Number hla
- Number matches
- Number of brothers, biological
- Number of children in household
- Number of days since last cigarette
- Number of days stayed off cigarettes
- Number of drugs used at visit
- Number of drugs used since last visit
- Number of eeg electrodes
- Number of ekg electrodes
- Number of emg electrodes
- Number of eog electrodes
- Number of frames
- Number of full term pregnancies
- Number of groups/cohorts
- Number of hospitalization days
- Number of hospitalizations
- Number of independent abberations in karyotype
- Number of intended intrathecal chemotherapy doses
- Number of letters correct
- Number of light bulbs
- Number of lines read
- Number of mines
- Number of months since last cigarette
- Number of months stayed off cigarettes
- Number of other lymph nodes examined
- Number of pack years smoked
- Number of para aortic lymph nodes examined
- Number of pelvic lymph nodes examined
- Number of prior regimens any therapy
- Number of prior regimens nsaid
- Number of prior regimens steroid
- Number of prostate cores positive for carcinoma
- Number of refills
- Number of regional lymph nodes positive
- Number of sisters, biological
- Number of trial sites eu state
- Number of weeks since last cigarette
- Number of weeks stayed off cigarettes
- Number of years since last cigarette
- Number of years stayed off cigarettes
- Number type
- Numbertext
- Numbness in the breast or chest area
- Numbness in the underarm, arm or hand
- Numbness in your arm
- Numbness or tingling question
- Numbness/tingling in hands/feet
- Numbness
- Numchrrd
- Numchrur
- Numeric age for data tabulation
- Numeric conversion
- Numeric echocardiogram test result unit
- Numeric echocardiogram test result
- Numeric lab test result unit
- Numeric lab test result
- Numeric minimal residual disease result unit
- Numeric minimal residual disease result
- Numeric rating scale 11-point
- Numeric rating scale 21 point
- Numeric rating scale 21-point
- Numeric rating scale 5 point
- Numeric rating scale 5-point
- Numeric rating scale 6-point
- Numeric result or finding in standard format
- Numeric value
- Numerical pain scale
- Numerical
- Numi
- Numlinur
- Nummular dermatitis
- Nummular
- Numrpt
- Numslice
- Nunnation
- Nup protein
- Nup214/dek fusion gene
- Nup98 add3 fusion gene
- Nup98 ddx10 fusion gene
- Nup98 hoxa9 fusion gene
- Nup98 hoxc13 fusion gene
- Nup98 hoxd11 fusion gene
- Nup98 hoxd13 fusion gene
- Nup98 nsd1 fusion gene
- Nup98-nup96 precursor
- Nup98/pmx1 fusion gene
- Nup98/rbbp2 fusion gene
- Nurf301, drosophila, homolog of gene
- Nurse and I work together to make decisions
- Nurse informaticist
- Nurse midwifery
- Nurse
- Nurses' health study
- Nursing health policy specialist
- Nursing home nursing
- Nursing home stay
- Nursing homes
- Nursing information system
- Nursing of the elderly
- Nursing profession
- Nursing sciences, clinical
- Nursing staff development specialist
- Nursing
- Nut banding stomach
- Nut bread
- Nut bypassing part digestive tract
- Nut gastric banding
- Nut gastric bypass surgery
- Nut mini nutritional assessment
- Nut mix antigen ige antibody
- Nut mix antigen igg antibody
- Nut mix ige ab rast score
- Nut mix igg ab rast score
- Nut simplified nutritional assessment
- Nut translocation
- Nut/brd4 fusion gene
- Nutm2a
- Nutm2b
- Nutmeg geranium
- Nutmeg
- Nutrient availability
- Nutrient drug interactions
- Nutrient offtake
- Nutrient resorption (physiology)
- Nutrient-rich bread mix iatta
- Nutrient
- Nutrients of public health concern
- Nutrifriend cachexia
- Nutrilite
- Nutrition Evidence Library (NEL) Systematic Review
- Nutrition Evidence Systematic Review
- Nutrition after surgery eras
- Nutrition and exercise during pregnancy
- Nutrition assessment
- Nutrition before surgery eras
- Nutrition during cancer treatment
- Nutrition for seniors
- Nutrition general considerations
- Nutrition in clinical medicine
- Nutrition in infants
- Nutrition monitoring
- Nutrition physiology
- Nutrition research
- Nutrition risk assessment
- Nutrition shared resource
- Nutrition surveys
- Nutrition, selenium
- Nutrition-genotype interaction
- Nutrition
- Nutritional anthropometry
- Nutritional calciopenic rickets
- Nutritional carcinogenesis
- Nutritional disorders
- Nutritional intervention
- Nutritional requirements
- Nutritional support
- Nutritional
- Nutriture
- Nuts and bolts
- Nuttalia
- Nuytsia
- Nv1020
- Nvac
- Nveltm
- Nvgrpid
- Nvisionvle imaging system
- Nvlnkgrp
- Nvlnkid
- Nvp-auy922-agb
- Nvp-bez235-nx
- Nvrefid
- Nvspid
- Nvstat
- Nvtptref
- Nwts
- Nwtsg stage I y
- Nwtsg stage ii y
- Nwtsg stage iii y
- Nwtsg staging system
- Ny eso 1/lage 1 hla class I/ii peptide vaccine
- Ny eso b
- Ny-eso-1 antibody
- Ny-eso-1 c259 t cells
- Ny-eso-1 positive tumor cells
- Ny-eso-1 tcr-transduced autologous pbmcs
- Ny-eso-1 tcr/sr39tk-modified autologous pbsc
- Ny-eso-1/mart-1 peptide-pulsed dc vaccine
- Ny-eso-1/mart-1/klh/montanide isa-51 vg vaccine
- Ny-eso-1b positive
- Ny-eso-2 antibody
- Ny-eso-2 positive
- Ny-esoc259t
- Nyanja
- Nyctalope
- Nyha class iv
- Nyha iii/iv
- Nyhan
- Nylidrin
- Nymphaea caerulea
- Nynrin
- Nyoro
- Nystagmic
- Nystagmograph
- Nystagmography
- Nystagmoid
- Nystagmus
- Nystatin/en
- Nzima
- Nzl
See also[edit source]
- Encyclopedia of Medicine
- List of Medical terms
- Cancer terms
- Drugs
- Cancer drugs
- Health topics
- Rare diseases
- List of lists
Medicine:Encyclopedia | Dictionary | Glossary | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | P1 | Q | R | R1 | S | S1 | T | T1 | U | V | W | X | Y | Z | 0-9 |
Popular Glossaries | Dictionaries | Lists & Glossaries | Topics |
---|---|---|---|
Search WikiMD
Ad.Tired of being Overweight? Try W8MD's physician weight loss program.
Semaglutide (Ozempic / Wegovy and Tirzepatide (Mounjaro / Zepbound) available.
Advertise on WikiMD
WikiMD's Wellness Encyclopedia |
Let Food Be Thy Medicine Medicine Thy Food - Hippocrates |
Translate this page: - East Asian
中文,
日本,
한국어,
South Asian
हिन्दी,
தமிழ்,
తెలుగు,
Urdu,
ಕನ್ನಡ,
Southeast Asian
Indonesian,
Vietnamese,
Thai,
မြန်မာဘာသာ,
বাংলা
European
español,
Deutsch,
français,
Greek,
português do Brasil,
polski,
română,
русский,
Nederlands,
norsk,
svenska,
suomi,
Italian
Middle Eastern & African
عربى,
Turkish,
Persian,
Hebrew,
Afrikaans,
isiZulu,
Kiswahili,
Other
Bulgarian,
Hungarian,
Czech,
Swedish,
മലയാളം,
मराठी,
ਪੰਜਾਬੀ,
ગુજરાતી,
Portuguese,
Ukrainian
Medical Disclaimer: WikiMD is not a substitute for professional medical advice. The information on WikiMD is provided as an information resource only, may be incorrect, outdated or misleading, and is not to be used or relied on for any diagnostic or treatment purposes. Please consult your health care provider before making any healthcare decisions or for guidance about a specific medical condition. WikiMD expressly disclaims responsibility, and shall have no liability, for any damages, loss, injury, or liability whatsoever suffered as a result of your reliance on the information contained in this site. By visiting this site you agree to the foregoing terms and conditions, which may from time to time be changed or supplemented by WikiMD. If you do not agree to the foregoing terms and conditions, you should not enter or use this site. See full disclaimer.
Credits:Most images are courtesy of Wikimedia commons, and templates Wikipedia, licensed under CC BY SA or similar.
Contributors: Prab R. Tumpati, MD